BPPCT001, BPPCT001 (genetic_marker) Prunus persica

Marker Overview
NameBPPCT001
Genbank IDN/A
TypeSSR
SpeciesPrunus persica
GermplasmOHenry
Source TypeGenomic DNA
Repeat Motif(GA)27
PCR Condition94 C 1 min, 94 C 45 sec, 57 C 45 sec, 72 C 2 min. 35 cycles, 72 C 4min
Primer 1BPPCT001.F primer: AATTCCCAAAGGATGTGTATGAG
Primer 2BPPCT001.Forward primer: AATTCCCAAAGGATGTGTATGAG
Primer 3BPPCT001.R primer: CAGGTGAATGAGCCAAAGC
Primer 4BPPCT001.Reverse primer: CAGGTGAATGAGCCAAAGC
Product Length159
Publication[view all]
ContactE. Dirlewanger
Contact
NameDetails
E. Dirlewanger
First name:Elisabeth
Last name:Dirlewanger
Institution:INRA
Address:Unite de Recherche sur les Especes Fruitieres et la Vigne, Centre de Bordeaux, BP 81, 33883 Villenave d Ornon cedex, France
Country:France
Email:dirlewan@bordeaux.inra.fr
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
R primerBPPCT001.R primerPrunus persicaprimer
F primerBPPCT001.F primerPrunus persicaprimer
Forward primerBPPCT001.Forward primerPrunus persicaprimer
Reverse primerBPPCT001.Reverse primerPrunus persicaprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
BPPCT001BPPCT001Prunus persicamarker_locus
BPPCT001-1BPPCT001-1Prunus persicamarker_locus
BPPCT001-3BPPCT001-3Prunus persicamarker_locus
BPPCT001BPPCT001-33.04Prunus persicamarker_locus


Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Markers Database2004-01-01
Germplasm
Stock NameType
OHenrycultivar
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Peach-AJ-F2-2005G2N/A40.9BPPCT001View
2Prunus Bin MapLG2N/A20.9BPPCT001View
3Peach-CF-F2-20142N/A61.93BPPCT001View
4Peach-AJ-F2G2N/A40.9BPPCT001View
5Peach-PF-BC1-2005G2N/A50.7BPPCT001View
6Prunus-TE-F2G2N/A20.9BPPCT001View
7Almond-NL-F1-2010G2N/A19.75BPPCT001View
8Peach_CxEL_F1CxEL2N/A39.3BPPCT001View
9Prunus-TE-F2-20152N/A18.3BPPCT001View
10Prunus-TE-BC1-T1EG2_T1EN/A12.7BPPCT001View
11Prunus-TxE-peachV2.0LG2N/A20.9BPPCT001View
12Peach-CA-BC1-2017LG2N/A35.4BPPCT001View
13Peach-CF-F2G2N/A36.1BPPCT001View
14Chokecherry-RCxSC-F1-2014SC IIbN/A37.5BPPCT001-1View
15Chokecherry-RCxSC-F1-2017Cho-10N/A56.07BPPCT001-1View
16Chokecherry-RCxSC-F1-2014SC IIbN/A40.2BPPCT001-3View
17Chokecherry-RCxSC-F1-2017Cho-10N/A60.1BPPCT001-3View
18Peach_Consensus_map_20182N/A33.04BPPCT001View
Alignments
Feature NameTypeLocationAnalysis
scaffold_2 supercontig scaffold_2:16134154..16134154. Prunus persica Whole Genome v1.0 Assembly & Annotation