BPPCT015 (genetic_marker) Prunus persica

Marker Overview
NameBPPCT015
Genbank IDN/A
TypeSSR
SpeciesPrunus persica
GermplasmOHenry
Source TypeGenomic DNA
genomic
Repeat Motif(AG)13
PCR Condition94 C 1 min, 94 C 45 sec, 57 C 45 sec, 72 C 2 min. 35 cycles, 72 C 4min
Primer 1BPPCT015.F primer: ATGGAAGGGAAGAGAAATCG
Primer 2BPPCT015.R primer: GTCATCTCAGTCAACTTTTCCG
Product Length150
PolymorphismP_ BPPCT015
Publication[view all]
ContactE. Dirlewanger
Contact
NameDetails
E. Dirlewanger
First name:Elisabeth
Last name:Dirlewanger
Institution:INRA
Address:Unite de Recherche sur les Especes Fruitieres et la Vigne, Centre de Bordeaux, BP 81, 33883 Villenave d Ornon cedex, France
Country:France
Email:dirlewan@bordeaux.inra.fr
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
R primerBPPCT015.R primerPrunus persicaprimer
F primerBPPCT015.F primerPrunus persicaprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
BPPCT015BPPCT015Prunus persicamarker_locus
nBPPCT015nBPPCT015Prunus persicamarker_locus
BPPCT015BPPCT015-49.4Prunus persicamarker_locus


Germplasm
Stock NameType
OHenrycultivar
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Peach-JF-F2G4N/A41.9BPPCT015View
2Peach-ScB-F2-2007G4N/A49.41BPPCT015View
3Prunus-TE-F2G4N/A44BPPCT015View
4Peach-GN-F2G4BN/A22BPPCT015View
5Peach-DG-F1-2009G4N/A57.6BPPCT015View
6Flowering Cherry-CYxE750-F1-CY6N/A37.7BPPCT015View
7Flowering Cherry-CYxE750-F1-E7506N/A12.8BPPCT015View
8Prunus-TE-F2-20154N/A37.6BPPCT015View
9Prunus-TE-BC1-T1EG4_T1EN/A37.9BPPCT015View
10Sweet Cherry-PAxPN-94G2N/A15.6nBPPCT015View
11Sweet Cherry-47G2N/A17.5nBPPCT015View
12Peach_Consensus_map_20184N/A49.4BPPCT015View