BPPCT024, BPPCT024 (genetic_marker) Prunus persica

Marker Overview
NameBPPCT024
Genbank IDN/A
TypeSSR
SpeciesPrunus persica
GermplasmOHenry
Source TypeGenomic DNA
Repeat Motif(AG)15
PCR Condition94 C 1 min, 94 C 45 sec, 57 C 45 sec, 72 C 2 min. 35 cycles, 72 C 4min
Primer 1BPPCT024.F primer: GAGGAATGTGCCTCTTCTGG
Primer 2BPPCT024.R primer: CTCCCGTACGCGTTTACC
Product Length96
PolymorphismP_ BPPCT024
Publication[view all]
ContactE. Dirlewanger
Contact
NameDetails
E. Dirlewanger
First name:Elisabeth
Last name:Dirlewanger
Institution:INRA
Address:Unite de Recherche sur les Especes Fruitieres et la Vigne, Centre de Bordeaux, BP 81, 33883 Villenave d Ornon cedex, France
Country:France
Email:dirlewan@bordeaux.inra.fr
Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Markers Database2004-01-01
Germplasm
Stock NameType
OHenryaccession
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Peach-AJ-F2-2005G2N/A64.4BPPCT024View
2Prunus-TE-F2G2N/A36.3BPPCT024View
3Apricot-GM-F1G2N/A51.6BPPCT024View
4Peach-DG-F1-2009G2N/A83BPPCT024View
5Peach-AJ-F2G2N/A64.4BPPCT024View
6Prunus-TxE-peachV2.0LG2N/A36.3BPPCT024View
7Sweet Cherry-PAxPN-94G2N/A73nBPPCT024View
8Sweet Cherry-47G2N/A74.7nBPPCT024View
Alignments
Feature NameTypeLocationAnalysis
scaffold_2 supercontig scaffold_2:22674207..22674207. Prunus persica Whole Genome v1.0 Assembly & Annotation