|
Marker Overview
Name | BPPCT027 |
Genbank ID | AF374937 |
Type | SSR |
Species | Prunus persica |
Germplasm | OHenry |
Source Type | Genomic DNA genomic |
Repeat Motif | (GA)11 |
PCR Condition | 94 C 1 min, 94 C 45 sec, 57 C 45 sec, 72 C 2 min. 35 cycles, 72 C 4min |
Primer 1 | BPPCT027.F primer: CTCTCAAGCATCATGGGC |
Primer 2 | BPPCT027.Forward primer: CTCTCAAGCATCATGGGC |
Primer 3 | BPPCT027.R primer: TGTTGCCCGGTTGTAATATC |
Primer 4 | BPPCT027.Reverse primer: TGTTGCCCGGTTGTAATATC |
Product Length | 249 |
Polymorphism | P_ BPPCT027 |
Publication | [view all] |
Contact | E. Dirlewanger
|
Analyses
This genetic_marker is derived from or has results from the following analyses
Publications
Year | Publication |
2002 | Dirlewanger E, Cosson P, Tavaud M, Aranzana J, Poizat C, Zanetto A, Arús P, Laigret F. Development of microsatellite markers in peach [ Prunus persica (L.) Batsch] and their use in genetic diversity analysis in peach and sweet cherry ( Prunus avium L.). TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2002 Jul; 105(1):127-138. |
2002 | Dirlewanger E, Cosson P, Tavaud M, Aranzana M, Poizat C, Zanetto A, Arus P, Laigret F. Development of microsatellite markers in peach [Prunus persica (L.) Batsch] and their use in genetic diversity analysis in peach and sweet cherry (Prunus avium L.). Theoretical and applied genetics. 2002 July; 105(1):127-138. |
Germplasm
Stock Name | Type |
OHenry | accession |
|