BPPCT034 (genetic_marker) Prunus persica

Marker Overview
NameBPPCT034
Genbank IDN/A
TypeSSR
SpeciesPrunus persica
GermplasmOHenry
Source TypeGenomic DNA
genomic
Repeat Motif(GA)19
PCR Condition94 C 1 min, 94 C 45 sec, 57 C 45 sec, 72 C 2 min. 35 cycles, 72 C 4min
Primer 1BPPCT034.F primer: CTACCTGAAATAAGCAGAGCCAT
Primer 2BPPCT034.R primer: CAATGGAGAATGGGGTGC
Product Length228
PolymorphismP_ BPPCT034
Publication[view all]
ContactE. Dirlewanger
Amy Iezzoni
Contact
NameDetails
E. Dirlewanger
First name:Elisabeth
Last name:Dirlewanger
Institution:INRA
Address:Unite de Recherche sur les Especes Fruitieres et la Vigne, Centre de Bordeaux, BP 81, 33883 Villenave d Ornon cedex, France
Country:France
Email:dirlewan@bordeaux.inra.fr
Amy Iezzoni
First name:Amy
Last name:Iezzoni
Title:Professor
Institution:Michigan State University
Address:A342 PSSB, East Lansing, MI 48824
Country:USA
Email:iezzoni@msu.edu
Phone:517-355-5191 x1391
Keywords:cherry breeder
Last update:Jun 2017
Germplasm
Stock NameType
OHenryaccession
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Peach-AJ-F2-2005G2N/A41.9BPPCT034View
2Sweet Cherry-EFxNY-F1-2008NY2N/A46.85BPPCT034View
3Sweet Cherry-EFxNY-F1-2008EF2N/A32.52BPPCT034View
4Peach-AJ-F2G2N/A41.9BPPCT034View
5Flowering Cherry-CYxE750-F1-CY2N/A49.2BPPCT034View
6Sweet Cherry-C-303xBeniyutaka-F1Pa2N/A76.26BPPCT034View
7Sweet Cherry-PAV_r1.0_consensus_map-F1Pa2N/A39.46BPPCT034View
8Sweet Cherry-QTL-HotSpot-Chr2-2017Chr02N/A40.2BPPCT034View