CH01H01 (genetic_marker) Malus domestica

Marker Overview
NameCH01H01
Genbank IDN/A
TypeSSR
SpeciesMalus x domestica
Repeat Motif(AG)25, 5
PCR ConditionPCR in 15 ul total volume with 10-50 ng DNA template and 0.3 to 0.7 pM of primers combined with 1.5 unites Taq Polymerase (Promega, Madison, Wis.), 1x Promega magnesium free buffer, 0.25 mM MgCl2, adn 0.25 mM dNTP (Promega). PCR amplifications were carried out using a PTC200 thermocycler (MJ Research, Reno, Nev.). The PCR proram had an initial denaturation step of 2 min at 95C followed by 30 cycles of 30 s at 95C, 30 s at 58C, 15 s at 72 C adn ending with a final extension step of 2 min at 72C. PCR rxn were diluted 1:1 in 95% formamide, 50 mM EDTA bromophenol blue loading dye, adn denatured at 95C for 3 min.
Primer 1CH01H01.F: GAAAGACTTGCAGTGGGAGC
Primer 2CH01H01.R: GGAGTGGGTTTGAGAAGGTT
Product Length114-134
PolymorphismP_ CH01H01
Publication[view all]
ContactC. Gessler
Miyuki Kunihisa
Publications
YearPublication
1998Theoretical and applied genetics. Theor. appl. genet. June 1998. v. 96 (8) p. 1069-1076. ISSN 0040-5752; THAGA6
2002Liebhard, R., Gianfranceschi, L., Koller, B., Ryder, C.D., Tarchini, R., Weg, E. van de., Gessler, C. Development and characterisation of 140 new microsatellites in apple (Malus x domestica Borkh.) Mol. breed. 2002. v. 10 (4) p. 217-241.
2006J. Amer. Soc. Hort. Sci. 131:408-417
2014Emeriewen O, Richter K, Kilian A, Zini E, Hanke M, Malnoy M, Peil A. Identification of a major quantitative trait locus for resistance to fire blight in the wild apple species Malus fusca. Molecular breeding. 2014; 34(2):407-419.
2010Velasco R, Zharkikh A, Affourtit J, Dhingra A, Cestaro A, Kalyanaraman A, Fontana P, Bhatnagar SK, Troggio M, Pruss D, Salvi S, Pindo M, Baldi P, Castelletti S, Cavaiuolo M, Coppola G, Costa F, Cova V, Dal Ri A, Goremykin V, Komjanc M, Longhi S, Magnago P, Malacarne G, Malnoy M, Micheletti D, Moretto M, Perazzolli M, Si-Ammour A, Vezzulli S, Zini E, Eldredge G, Fitzgerald LM, Gutin N, Lanchbury J, Macalma T, Mitchell JT, Reid J, Wardell B, Kodira C, Chen Z, Desany B, Niazi F, Palmer M, Koepke T, Jiwan D, Schaeffer S, Krishnan V, Wu C, Chu VT, King ST, Vick J, Tao Q, Mraz A, Stormo A, Stormo K, Bogden R, Ederle D, Stella A, Vecchietti A, Kater MM, Masiero S, Lasserre P, Lespinasse Y, Allan AC, Bus V, Chagné D, Crowhurst RN, Gleave AP, Lavezzo E, Fawcett JA, Proost S, Rouzé P, Sterck L, Toppo S, Lazzari B, Hellens RP, Durel CE, Gutin A, Bumgarner RE, Gardiner SE, Skolnick M, Egholm M, Van de Peer Y, Salamini F, Viola R. The genome of the domesticated apple (Malus x domestica Borkh.). Nature Genetics. 2010 Oct; 42(10):833-839.
2006Silfverberg-Dilworth E, Matasci CL, Van de Weg WE, Van Kaauwen MPW, Walser M, Kodde LP, Soglio V, Gianfranceschi L, Durel CE, Costa F, Yamamoto T, Koller B, Gessler C Patocchi A. Microsatellite markers spanning the apple (Malus x domestica Borkh.) genome. Tree Genetics and Genomes. 2006; 2(4):202-224.
2004Yamamoto T, Kimura T, Saito T, Kotobuki K, Matsuta N, Liebhard R, Gessler C, Weg W.E. van de, Hayashi, T. Genetic linkage maps of Japanese and European pears aligned to the apple consensus map. Acta Horticulturae. 2004; 663:51-56.
2012Schouten HJ, van de Weg WE, Carling J, Khan SI, McKay SJ, van Kaauwen MPW, Wittenberg AHJ, Koehorst-van Putten HJJ, Noordijk Y, Gao Z, Rees DJG, Van Dyk MM, Jaccoud D, Considine MJ, Kilian A. Diversity arrays technology (DArT) markers in apple for genetic linkage maps. Molecular breeding 2012 29:645–660
2012Antanaviciute L, Fernández-Fernández F, Jansen J, Banchi E, Evans KM, Viola R, Velasco R, Dunwell JM, Troggio M, Sargent DJ. Development of a dense SNP-based linkage map of an apple rootstock progeny using the Malus Infinium whole genome genotyping array. BMC genomics. 2012; 13:203.
2014Kunihisa M, Moriya S, Abe K, Okada K, Haji T, Hayashi T, Kim H, Nishitani C, Terakami S, Yamamoto T. Identification of QTLs for fruit quality traits in Japanese apples: QTLs for early ripening are tightly related to preharvest fruit drop. Breeding science. 2014 Sep; 64(3):240-51.
2015Ben Sadok I, Tiecher A, Galvez-Lopez D, Lahaye M, Lasserre-Zuber P, Bruneau M, Hanteville S, Robic R, Cournol R, Laurens F. Apple fruit texture QTLs: year and cold storage effects on sensory and instrumental traits. Tree Genetics & Genomes 2015 11:119
2004Plant Breeding, 123(4):321
Contact
NameDetails
C. Gessler
First name:Cesare
Last name:Gessler
Institution:ETH Zurich
Address:ZTH Zurich Institut f. Integrative Biologie LFW C 15 Universitatstrasse 2 8092 Zurich
Country:Switzerland
Email:cesare.gessler@agrl.ethz.ch
Phone:+41 44 632 38 71
Fax:+41 (0) 632 11 08
Last update:May 2002
Miyuki Kunihisa
First name:Miyuki
Last name:Kunihisa
Institution:NARO Institute of Fruit Tree Science
Address:2-1 Fujimoto, Tsukuba, Ibaraki 305-8605
Country:Japan
Email:miyuky@affrc.go.jp
Phone:81-29-838-6437
Keywords:fruit drop
Relationships

This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
resistance to Venturia inaequalisqRVI.PF-F17.2003.302.1Malus x domesticaQTL
resistance to Venturia inaequalisqRVI.PF-F17.1.2003.EUMalus x domesticaQTL
resistance to Venturia inaequalisqRVI.PF-F17.2003.302Malus x domesticaQTL


This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
FCH01H01.FMalus x domesticaprimer
RCH01H01.RMalus x domesticaprimer


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
resistance to Venturia inaequalisqRVI.GxDR.-ch17Malus x domesticaQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
CH01h01CH01h01Malus x domesticamarker_locus
CH01h01CH01h01-9.4Malus x domesticamarker_locus
CH01h01CH01h01-23.7Malus x domesticamarker_locus
CH01H01CH01H01-8Malus x domesticamarker_locus
CH01H01CH01H01-61.4Malus x domesticamarker_locus
CH01H01CH01H01-61.082Malus x domesticamarker_locus
CH01H01CH01H01-61.858Malus x domesticamarker_locus
CH01H01CH01H01-102.96Malus x domesticamarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple Integrated map17N/A19CH01h01View
2Apple-FD-F1-2006F17N/A15CH01h01View
3Apple-FD-F1-2006D17N/A24.5CH01h01View
4Pear-BH-F1Ba17N/A10.7CH01h01View
5Apple-GaxDR-F1LG17N/A16.6CH01h01View
6Pear-BH-F1Ho17N/A10.6CH01h01View
7Apple-MAL0045_x_Idared-F1-MfuscaLG17N/A32.1CH01h01View
8Apple-2000-2012-F1ch17N/A18CH01h01View
9Apple-PF-F1-2012ch17N/A21CH01h01View
10Apple-MM-F117N/A17.4CH01h01View
11Apple-OA-F1-AkaneAK17-1N/A12CH01h01View
12Apple-X3259X3263-F117N/A19.64CH01h01View
13Apple-M432-2012LG17N/A17.9CH01h01View
14Apple-RGTxGD-F1-2015RGT_17N/A10.11CH01h01View
15Apple-RGTxGD-F1-2015GD_17N/A22.62CH01h01View
16Pear-AN-F1LG17N/A10.6CH01h01View
17Apple-RGxPI6-F1LG17N/A25.3CH01h01View
18Apple-JM7xS63-F1J17N/A9.4CH01h01View
19Apple-FjxPL-F1-2013LG17N/A32.51CH01h01View
20Pear-BD-F1-2014-geneticLG17N/A82.7CH01h01View
21Pear-Bartlett-F1-2007Ba17N/A11CH01h01View
22Pear-La_France-F1-2007La17N/A26.9CH01h01View
23Apple-FD-Discovery-F1-2003D17N/A25.8CH01h01View
24Apple-JM7xS63-F1J17N/A9.4CH01h01View
25Apple-JM7xS63-F1S17N/A23.7CH01h01View
26Pear-Ba-F1-2013Ba17N/A8CH01H01View
27Pear-BD-F1-2015LG17N/A61.4CH01H01View
28Pear-Bayuehong-F1-2015LG17N/A61.08CH01H01View
29Pear-Dangshansuli-F1-2015LG17N/A61.86CH01H01View
30Pear-integrated_consensus_map-IPCG-2017LG17N/A102.96CH01H01View