CH01h02 (genetic_marker) Malus domestica

Marker Overview
NameCH01h02
Genbank IDN/A
TypeSSR
SpeciesMalus x domestica
Repeat MotifGA
PCR Conditionannealing temp 60 degree
Primer 1CH01H02.F: AGAGCTTCGAGCTTCGTTTG
Primer 2CH01H02.R: ATCTTTTGGTGCTCCCACAC
Product Length236-256
236–256
Max Length248 bp
PolymorphismP_ CH01h02
Publication[view all]
ContactC. Gessler
Publications
YearPublication
1998Theoretical and applied genetics. Theor. appl. genet. June 1998. v. 96 (8) p. 1069-1076. ISSN 0040-5752; THAGA6
2002Liebhard, R., Gianfranceschi, L., Koller, B., Ryder, C.D., Tarchini, R., Weg, E. van de., Gessler, C. Development and characterisation of 140 new microsatellites in apple (Malus x domestica Borkh.) Mol. breed. 2002. v. 10 (4) p. 217-241.
2010Velasco R, Zharkikh A, Affourtit J, Dhingra A, Cestaro A, Kalyanaraman A, Fontana P, Bhatnagar SK, Troggio M, Pruss D, Salvi S, Pindo M, Baldi P, Castelletti S, Cavaiuolo M, Coppola G, Costa F, Cova V, Dal Ri A, Goremykin V, Komjanc M, Longhi S, Magnago P, Malacarne G, Malnoy M, Micheletti D, Moretto M, Perazzolli M, Si-Ammour A, Vezzulli S, Zini E, Eldredge G, Fitzgerald LM, Gutin N, Lanchbury J, Macalma T, Mitchell JT, Reid J, Wardell B, Kodira C, Chen Z, Desany B, Niazi F, Palmer M, Koepke T, Jiwan D, Schaeffer S, Krishnan V, Wu C, Chu VT, King ST, Vick J, Tao Q, Mraz A, Stormo A, Stormo K, Bogden R, Ederle D, Stella A, Vecchietti A, Kater MM, Masiero S, Lasserre P, Lespinasse Y, Allan AC, Bus V, Chagné D, Crowhurst RN, Gleave AP, Lavezzo E, Fawcett JA, Proost S, Rouzé P, Sterck L, Toppo S, Lazzari B, Hellens RP, Durel CE, Gutin A, Bumgarner RE, Gardiner SE, Skolnick M, Egholm M, Van de Peer Y, Salamini F, Viola R. The genome of the domesticated apple (Malus x domestica Borkh.). Nature Genetics. 2010 Oct; 42(10):833-839.
2006Silfverberg-Dilworth E, Matasci CL, Van de Weg WE, Van Kaauwen MPW, Walser M, Kodde LP, Soglio V, Gianfranceschi L, Durel CE, Costa F, Yamamoto T, Koller B, Gessler C Patocchi A. Microsatellite markers spanning the apple (Malus x domestica Borkh.) genome. Tree Genetics and Genomes. 2006; 2(4):202-224.
2004Yamamoto T, Kimura T, Saito T, Kotobuki K, Matsuta N, Liebhard R, Gessler C, Weg W.E. van de, Hayashi, T. Genetic linkage maps of Japanese and European pears aligned to the apple consensus map. Acta Horticulturae. 2004; 663:51-56.
2012Schouten HJ, van de Weg WE, Carling J, Khan SI, McKay SJ, van Kaauwen MPW, Wittenberg AHJ, Koehorst-van Putten HJJ, Noordijk Y, Gao Z, Rees DJG, Van Dyk MM, Jaccoud D, Considine MJ, Kilian A. Diversity arrays technology (DArT) markers in apple for genetic linkage maps. Molecular breeding 2012 29:645–660
2012Antanaviciute L, Fernández-Fernández F, Jansen J, Banchi E, Evans KM, Viola R, Velasco R, Dunwell JM, Troggio M, Sargent DJ. Development of a dense SNP-based linkage map of an apple rootstock progeny using the Malus Infinium whole genome genotyping array. BMC genomics. 2012; 13:203.
2015Ben Sadok I, Tiecher A, Galvez-Lopez D, Lahaye M, Lasserre-Zuber P, Bruneau M, Hanteville S, Robic R, Cournol R, Laurens F. Apple fruit texture QTLs: year and cold storage effects on sensory and instrumental traits. Tree Genetics & Genomes 2015 11:119
2004Plant Breeding, 123(4):321
Contact
NameDetails
C. Gessler
First name:Cesare
Last name:Gessler
Institution:ETH Zurich
Address:ZTH Zurich Institut f. Integrative Biologie LFW C 15 Universitatstrasse 2 8092 Zurich
Country:Switzerland
Email:cesare.gessler@agrl.ethz.ch
Phone:+41 44 632 38 71
Fax:+41 (0) 632 11 08
Last update:May 2002
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
FCH01H02.FMalus x domesticaprimer
RCH01H02.RMalus x domesticaprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
CH01h02CH01h02Malus x domesticamarker_locus
CH01h02CH01h02-137.821Malus x domesticamarker_locus
CH01h02CH01h02-95.631Malus x domesticamarker_locus
CH01h02CH01h02-120.532Malus x domesticamarker_locus
CH01h02CH01h02-45.5Malus x domesticamarker_locus
CH01h02CH01h02-53.7Malus x domesticamarker_locus
CH01h02CH01h02-51.1Malus x domesticamarker_locus
CH01h02CH01h02-164.31Malus x domesticamarker_locus
CH01h02CH01h02-216.21Malus x domesticamarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-FD-F1-2006F9N/A44.3CH01h02View
2Pear-BH-F1Ba9N/A50.1CH01h02View
3Pear-BH-F1Ho9N/A41.5CH01h02View
4Apple Integrated map9N/A56.4CH01h02View
5Apple-FD-F1-2006D9N/A58.9CH01h02View
6Pear-PM-F1-PEAR39N/A49.84CH01h02View
7Pear-PM-F1-Moonglow9N/A44.16CH01h02View
8Apple-2000-2012-F1ch9N/A49CH01h02View
9Apple-PF-F1-2012ch9N/A64CH01h02View
10Apple-MM-F19N/A56.5CH01h02View
11Apple-X3259X3263-F19N/A50.02CH01h02View
12Apple-M432-2012LG9N/A51.5CH01h02View
13Apple-RGTxGD-F1-2015RGT_9N/A42.77CH01h02View
14Apple-RGTxGD-F1-2015GD_9N/A55.83CH01h02View
15Apple-DP-F1-2013D9N/A59CH01h02View
16Apple-DP-F1-2013P9N/A59CH01h02View
17Apple-X5210X8402-F1-X8402LG9N/A71CH01h02View
18Pear-Bartlett-F1-2007Ba9N/A45CH01h02View
19Apple-FD-Discovery-F1-2003D9N/A59.8CH01h02View
20Pear-Rcf-F1-femaleLG9N/A137.82CH01h02View
21Pear-M-F1-maleLG9N/A95.63CH01h02View
22Pear-RM-F1-IntegratedLG9N/A120.53CH01h02View
23Apple-JM7xS63-F1J9N/A45.5CH01h02View
24Apple-JM7xS63-F1S9N/A53.7CH01h02View
25Pear-Ba-F1-2013Ba9N/A51.1CH01h02View
26Pear-integrated_consensus_map-IPCG-2017LG9N/A164.31CH01h02View
27Pear-integrated_consensus_map-IPCG-2017LG17N/A216.21CH01h02View