|
Marker Overview
Name | CH02D12 |
Genbank ID | N/A |
Type | SSR |
Species | Malus x domestica |
Repeat Motif | (GA)19 |
PCR Condition | PCR in 15 ul total volume with 10-50 ng DNA template and 0.3 to 0.7 pM of primers combined with 1.5 unites Taq Polymerase (Promega, Madison, Wis.), 1x Promega magnesium free buffer, 0.25 mM MgCl2, adn 0.25 mM dNTP (Promega). PCR amplifications were carried out using a PTC200 thermocycler (MJ Research, Reno, Nev.). The PCR proram had an initial denaturation step of 2 min at 95C followed by 30 cycles of 30 s at 95C, 30 s at 58C, 15 s at 72 C adn ending with a final extension step of 2 min at 72C. PCR rxn were diluted 1:1 in 95% formamide, 50 mM EDTA bromophenol blue loading dye, adn denatured at 95C for 3 min. 94 °C for 5 min, 35x (94 °C for 60 s, 55 °C for 60 s, 72 °C for 60 s), 72°C for 10 min |
Primer 1 | CH02D12.F: AACCAGATTTGCTTGCCATC |
Primer 2 | CH02D12.R: GCTGGTGGTAAACGTGGTG |
Primer 3 | CH02d12-Forward: AACCAGATTTGCTTGCCATC |
Primer 4 | CH02d12-Reverse: GCTGGTGGTAAACGTGGTG |
Product Length | 177-199 244-245 |
Max Length | 245 |
Polymorphism | P_ CH02D12 |
Publication | [view all] |
Contact | C. Gessler Miyuki Kunihisa
|
Publications
Year | Publication |
1998 | Theoretical and applied genetics. Theor. appl. genet. June 1998. v. 96 (8) p. 1069-1076. ISSN 0040-5752; THAGA6 |
2002 | Liebhard, R., Gianfranceschi, L., Koller, B., Ryder, C.D., Tarchini, R., Weg, E. van de., Gessler, C. Development and characterisation of 140 new microsatellites in apple (Malus x domestica Borkh.) Mol. breed. 2002. v. 10 (4) p. 217-241. |
2006 | J. Amer. Soc. Hort. Sci. 131:408-417 |
2006 | Silfverberg-Dilworth E, Matasci CL, Van de Weg WE, Van Kaauwen MPW, Walser M, Kodde LP, Soglio V, Gianfranceschi L, Durel CE, Costa F, Yamamoto T, Koller B, Gessler C Patocchi A. Microsatellite markers spanning the apple (Malus x domestica Borkh.) genome. Tree Genetics and Genomes. 2006; 2(4):202-224. |
2012 | Schouten HJ, van de Weg WE, Carling J, Khan SI, McKay SJ, van Kaauwen MPW, Wittenberg AHJ, Koehorst-van Putten HJJ, Noordijk Y, Gao Z, Rees DJG, Van Dyk MM, Jaccoud D, Considine MJ, Kilian A. Diversity arrays technology (DArT) markers in apple for genetic linkage maps. Molecular breeding 2012 29:645–660 |
2014 | Kunihisa M, Moriya S, Abe K, Okada K, Haji T, Hayashi T, Kim H, Nishitani C, Terakami S, Yamamoto T. Identification of QTLs for fruit quality traits in Japanese apples: QTLs for early ripening are tightly related to preharvest fruit drop. Breeding science. 2014 Sep; 64(3):240-51. |
|