CPPCT005 (genetic_marker) Prunus persica

Marker Overview
NameCPPCT005
Genbank IDN/A
TypeSSR
SpeciesPrunus persica
Source TypeGenomic DNA
Repeat Motif(CT)25
PCR Condition94 C 1 min, 94 C 30 sec, 52 C 30 sec, 72 C 1 min. 34 cycles, 72 C 5min
Primer 1CPPCT005.Forward Primer: CATGAACTCTACTCTCCATGGTATGGACTCACCAAC
Primer 2CPPCT005.primer 1: CATGAACTCTACTCTCCATGGTATGGACTCACCAAC
Product Length160
Publication[view all]
ContactE. Dirlewanger
Maria Badenes
Contact
NameDetails
E. Dirlewanger
First name:Elisabeth
Last name:Dirlewanger
Institution:INRA
Address:Unite de Recherche sur les Especes Fruitieres et la Vigne, Centre de Bordeaux, BP 81, 33883 Villenave d Ornon cedex, France
Country:France
Email:dirlewan@bordeaux.inra.fr
Maria Badenes
First name:Maria 
Last name:Badenes
Institution:Instituto Valenciano de Investigaciones Agrarias (IVIA)
Address:Instituto Valenciano de Investigaciones Agrarias, Apartado Oficial 46113 Moncada, Valencia, Spain
Country:Spain
Email:badenes_mlu@gva.es
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
primer 1CPPCT005.primer 1Prunus persicaprimer
Forward PrimerCPPCT005.Forward PrimerPrunus persicaprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
germination dateqGMD-LAxF.LG4Prunus persicaQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
CPPCT005CPPCT005Prunus persicamarker_locus
cppct005-ccppct005-cPrunus persicamarker_locus
CPPCT005BCPPCT005BPrunus persicamarker_locus
CPPCT005ACPPCT005APrunus persicamarker_locus
cppct005-ecppct005-ePrunus persicamarker_locus
cppct005a_acccppct005a_accPrunus persicamarker_locus
CPPCT005CPPCT005-9.91Prunus persicamarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Peach-JF-F2G2N/A31CPPCT005View
2Almond-NL-F1-2010G4N/A5.94CPPCT005View
3Peach-AJ-F2-2005G4N/A13.6CPPCT005View
4Peach-AJ-F2G4N/A13.6CPPCT005View
5Prunus-TE-F2G4N/A10.4CPPCT005View
6Prunus-TE-F2-20154N/A6.6CPPCT005View
7Peach-LAxFG-F2LG4N/A0CPPCT005View
8Peach-DvsS-BC2LG4N/A11CPPCT005View
9Prunus-TE-BC1-T1EG4_T1EN/A14.6CPPCT005View
10Prunus-TE-BC1-EG4_EN/A17.7CPPCT005View
11Peach-DG-F1-2009G1N/A83.3cppct005-cView
12Peach-DG-F1-2009G6N/A91.1cppct005-cView
13Peach-DG-F1-2009G2N/A31.7CPPCT005BView
14Peach-DG-F1-2009G4N/A11.9CPPCT005AView
15Peach-DG-F1-2009G6N/A36.1cppct005-eView
16Peach-DG-F1-2009G4N/A41.3cppct005a_accView
17Peach_Consensus_map_20184N/A9.91CPPCT005View