CPPCT005 (genetic_marker) Prunus persica | GDR

Marker Overview

Annotated Terms

Marker Overview


Name	CPPCT005
Genbank ID	N/A
Type	SSR
Species	Prunus persica
Source Type	Genomic DNA
Repeat Motif	(CT)25
PCR Condition	94 C 1 min, 94 C 30 sec, 52 C 30 sec, 72 C 1 min. 34 cycles, 72 C 5min
Primer 1	CPPCT005.Forward Primer: CATGAACTCTACTCTCCATGGTATGGACTCACCAAC
Primer 2	CPPCT005.primer 1: CATGAACTCTACTCTCCATGGTATGGACTCACCAAC
Product Length	160
Publication	[view all]
Contact	E. Dirlewanger Maria Badenes
Associated With	GWAS0001936 GWAS0001942

Contact

Name

Details

E. Dirlewanger

First name:	Elisabeth
Last name:	Dirlewanger
Institution:	INRA
Address:	Unite de Recherche sur les Especes Fruitieres et la Vigne, Centre de Bordeaux, BP 81, 33883 Villenave d Ornon cedex, France
Country:	France
Email:	dirlewan@bordeaux.inra.fr

Maria Badenes

First name:	Maria
Last name:	Badenes
Institution:	Instituto Valenciano de Investigaciones Agrarias (IVIA)
Address:	Instituto Valenciano de Investigaciones Agrarias, Apartado Oficial 46113 Moncada, Valencia, Spain
Country:	Spain
Email:	badenes_mlu@gva.es

Publications


Year	Publication
2002	Plant breeding = Zeitschrift fr Pflanzenzchtung. Plant breed. Feb 2002. v. 121 (1) p. 87-92. ISSN 0179-9541; PLABED
2005	Yamamoto T, Yamaguchi M, Hayashi T. An Integrated Genetic Linkage Map of Peach by SSR, STS, AFLP and RAPD. Journal of the Japanese Society for Horticultural Science. 2005; 74(3):204-213.
2002	Dirlewanger E, Cosson P, Tavaud M, Aranzana J, Poizat C, Zanetto A, Arús P, Laigret F. Development of microsatellite markers in peach [ Prunus persica (L.) Batsch] and their use in genetic diversity analysis in peach and sweet cherry ( Prunus avium L.). TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2002 Jul; 105(1):127-138.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Peach-JF-F2	G2	N/A	31	CPPCT005	View
2	Almond-NL-F1-2010	G4	N/A	5.94	CPPCT005	View
3	Peach-AJ-F2-2005	G4	N/A	13.6	CPPCT005	View
4	Peach-AJ-F2	G4	N/A	13.6	CPPCT005	View
5	Prunus-TE-F2	G4	N/A	10.4	CPPCT005	View
6	Prunus-TE-F2-2015	4	N/A	6.6	CPPCT005	View
7	Peach-LAxFG-F2	LG4	N/A	0	CPPCT005	View
8	Peach-DvsS-BC2	LG4	N/A	11	CPPCT005	View
9	Prunus-TE-BC1-T1E	G4_T1E	N/A	14.6	CPPCT005	View
10	Prunus-TE-BC1-E	G4_E	N/A	17.7	CPPCT005	View
11	Peach-DG-F1-2009	G1	N/A	83.3	cppct005-c	View
12	Peach-DG-F1-2009	G6	N/A	91.1	cppct005-c	View
13	Peach-DG-F1-2009	G2	N/A	31.7	CPPCT005B	View
14	Peach-DG-F1-2009	G4	N/A	11.9	CPPCT005A	View
15	Peach-DG-F1-2009	G6	N/A	36.1	cppct005-e	View
16	Peach-DG-F1-2009	G4	N/A	41.3	cppct005a_acc	View
17	Peach_Consensus_map_2018	4	N/A	9.91	CPPCT005	View

Annotated Terms

The following terms have been associated with this genetic_marker:

Vocabulary: **Rosaceae Trait Ontology**
Term	Definition
MAIN:000192249	chilling requirement
28:full bloom date	flower date 100%