CPPCT028, CPPCT028 (genetic_marker) Prunus persica

Marker Overview
NameCPPCT028
Genbank IDN/A
TypeSSR
SpeciesPrunus persica
Source TypeGenomic DNA
Repeat Motif(CT)16
PCR Condition94 C 1 min, 94 C 30 sec, 50 C 30 sec, 72 C 1 min. 34 cycles, 72 C 5min
Primer 1CPPCT028.Forward Primer: ACATATGCCTTATCAGCTTATTGAAGAGAAAGCAGTGT
Primer 2CPPCT028.primer 1: ACATATGCCTTATCAGCTTATTGAAGAGAAAGCAGTGT
Product Length130
Publication[view all]
ContactE. Dirlewanger
Maria Badenes
Contact
NameDetails
E. Dirlewanger
First name:Elisabeth
Last name:Dirlewanger
Institution:INRA
Address:Unite de Recherche sur les Especes Fruitieres et la Vigne, Centre de Bordeaux, BP 81, 33883 Villenave d Ornon cedex, France
Country:France
Email:dirlewan@bordeaux.inra.fr
Maria Badenes
First name:Maria 
Last name:Badenes
Institution:Instituto Valenciano de Investigaciones Agrarias (IVIA)
Address:Instituto Valenciano de Investigaciones Agrarias, Apartado Oficial 46113 Moncada, Valencia, Spain
Country:Spain
Email:badenes_mlu@gva.es
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
primer 1CPPCT028.primer 1Prunus persicaprimer
Forward PrimerCPPCT028.Forward PrimerPrunus persicaprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
ripening timeqRPT.RD-ch4.1Prunus dulcisQTL


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
resistance to Monilinia fructicolaqRMF.CxEL-LG4.2009.Fl-rd.1Prunus persicaQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
CPPCT028CPPCT028Prunus persicamarker_locus
CPPCT028CPPCT028-14.2Prunus persicamarker_locus


Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Markers Database2004-01-01
Alignment of genetic markers to Prunus persics v2.02019-04-11
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Peach-AJ-F2-2005G4N/A12.2CPPCT028View
2Almond-RD-F1G4N/A14.2CPPCT028View
3Peach-DG-F1-2009G4N/A17.3CPPCT028View
4Peach-AJ-F2G4N/A12.2CPPCT028View
5Prunus-TE-F2G4N/A11CPPCT028View
6Peach-VV-F2G4N/A8.2CPPCT028View
7Peach_CxEL_F1CxEL4N/A7.1CPPCT028View
8Peach_CxEL_F1-physical-Prunus-persicaV1.0CxEL4N/A2086534CPPCT028View
9Prunus-TE-BC1-T1EG1_T1EN/A51.2CPPCT028View
10Prunus-TxE-peachV2.0LG4N/A11CPPCT028View
11Peach_Consensus_map_20184N/A14.2CPPCT028View
Alignments
Feature NameTypeLocationAnalysis
scaffold_4 supercontig scaffold_4:2086534..2086831. Prunus persica Whole Genome v1.0 Assembly & Annotation
Pp04 chromosome Pp04:2086637..2086934+ Prunus persica Whole Genome Assembly v2.0 & Annotation v2.1 (v2.0.a1)