CPSCT038, CPSCT038 (genetic_marker) Prunus salicina

Marker Overview
NameCPSCT038
Genbank IDAY426223
TypeSSR
SpeciesPrunus salicina
GermplasmSanta Rosa
Source Typegenomic DNA
genomic
Repeat Motif(GA)18
PCR Condition94 C 1 min, 94 C 30 sec, 62 C 30 sec, 72 C 30 sec. 35 cycles, 72 C 5min
Primer 1CPSCT038.F primer: CAGGAACCCTATTCCCACAA
Primer 2CPSCT038.Forward Primer: CAGGAACCCTATTCCCACAA
Primer 3CPSCT038.R primer: TCAATGGCACCCATTTTACA
Primer 4CPSCT038.Reverse Primer: TCAATGGCACCCATTTTACA
Product Length200
PolymorphismP_ CPSCT038
Publication[view all]
ContactP. Arus
Amy Iezzoni
Maria Badenes
Contact
NameDetails
P. Arus
First name:Pere
Last name:Arus
Institution:IRTA
Address:Institut de Recerca I Tecnologia Agroalimentaries (IRTA), Departament de Genetica Vegetal, Carretera de Cabrils s/n, 08348 Cabrils, Spain
Email:pere.arus@irta.es
Amy Iezzoni
First name:Amy
Last name:Iezzoni
Title:Professor
Institution:Michigan State University
Address:A342 PSSB, East Lansing, MI 48824
Country:USA
Email:iezzoni@msu.edu
Phone:517-355-5191 x1391
Keywords:cherry breeder
Last update:Jun 2017
Maria Badenes
First name:Maria 
Last name:Badenes
Institution:Instituto Valenciano de Investigaciones Agrarias (IVIA)
Address:Instituto Valenciano de Investigaciones Agrarias, Apartado Oficial 46113 Moncada, Valencia, Spain
Country:Spain
Email:badenes_mlu@gva.es
Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Markers Database2004-01-01
Alignment of genetic markers to Prunus persics v2.02019-04-11
Germplasm
Stock NameType
Santa Rosaaccession
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Prunus Bin MapLG2N/A9.6CPSCT038View
2Sweet Cherry-EFxNY-F1-2008NY2N/A27.83CPSCT038View
3Sweet Cherry-EFxNY-F1-2008EF2N/A23.14CPSCT038View
4Flowering Cherry-CYxE750-F1-CY2N/A45.2CPSCT038View
5Flowering Cherry-CYxE750-F1-E7502N/A0CPSCT038View
6Sweet Cherry-QTL-HotSpot-Chr2-2017Chr02N/A29.3CPSCT038View
7Sweet Cherry-PAxPN-94G2N/A43.3aCPSCT038View
8Sweet Cherry-47G2N/A44.8aCPSCT038View
Alignments
Feature NameTypeLocationAnalysis
scaffold_2 supercontig scaffold_2:15057199..15057872. Prunus persica Whole Genome v1.0 Assembly & Annotation
Pp02 chromosome Pp02:17835367..17836040+ Prunus persica Whole Genome Assembly v2.0 & Annotation v2.1 (v2.0.a1)
Pp02 chromosome Pp02:18440199..18440948+ Prunus persica Whole Genome Assembly v2.0 & Annotation v2.1 (v2.0.a1)