CPSCT039, CPSCT039 (genetic_marker) Prunus salicina

Marker Overview
NameCPSCT039
Genbank IDAY426224
TypeSSR
SpeciesPrunus salicina
GermplasmSanta Rosa
Source Typegenomic DNA
Repeat Motif(GA)18
PCR Condition94 C 1 min, 94 C 30 sec, 62 C 30 sec, 72 C 30 sec. 35 cycles, 72 C 5min
95 C 5 min. 95 C 30 sec, 62 C 30 sec, 72 C 30 sec for 34 cycles. 72 C 7 min.
Primer 1CPSCT039.F primer: GCCGCAACTCGTAAGGAATA
Primer 2CPSCT039.Forward Primer: GCCGCAACTCGTAAGGAATA
Primer 3CPSCT039.R primer: TCCACCGTTGATTACCCTTC
Primer 4CPSCT039.Reverse Primer: TCCACCGTTGATTACCCTTC
Product Length122
122 bp
Publication[view all]
ContactP. Arus
W. Shu-Biao
Maria Badenes
Contact
NameDetails
P. Arus
First name:Pere
Last name:Arus
Institution:IRTA
Address:Institut de Recerca I Tecnologia Agroalimentaries (IRTA), Departament de Genetica Vegetal, Carretera de Cabrils s/n, 08348 Cabrils, Spain
Email:pere.arus@irta.es
W. Shu-Biao
First name:Shu-Biao
Last name:Wu
Institution:University of New England
Address:School of Environmental and Rural Science, University of New England, Armidale NSW, Australia
Email:shubiao.wu@une.edu.au
Phone:61 2 6773 2238
Maria Badenes
First name:Maria 
Last name:Badenes
Institution:Instituto Valenciano de Investigaciones Agrarias (IVIA)
Address:Instituto Valenciano de Investigaciones Agrarias, Apartado Oficial 46113 Moncada, Valencia, Spain
Country:Spain
Email:badenes_mlu@gva.es
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
R primerCPSCT039.R primerPrunus salicinaprimer
F primerCPSCT039.F primerPrunus salicinaprimer
Forward PrimerCPSCT039.Forward PrimerPrunus salicinaprimer
Reverse PrimerCPSCT039.Reverse PrimerPrunus salicinaprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
CPSCT039CPSCT039Prunus salicinamarker_locus
CPSCT039-B1CPSCT039-B1Prunus salicinamarker_locus
CPSCT039-B2CPSCT039-B2Prunus salicinamarker_locus


Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Markers Database2004-01-01
Alignment of genetic markers to Prunus persics v2.02019-04-11
Germplasm
Stock NameType
Santa Rosacultivar
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Peach-JF-F2G4N/A0CPSCT039View
2Prunus-TE-F2G4N/A1.8CPSCT039View
3Peach-PIxSL-F2LG4N/A0CPSCT039View
4Peach_CxEL_F1CxEL4N/A0CPSCT039View
5Peach-HU-F2G4N/A0CPSCT039View
6Peach-DvsS-BC2LG4N/A4CPSCT039View
7Prunus-TxE-peachV2.0LG4N/A1.8CPSCT039View
8Peach-CA-BC1-2017LG4N/A1.3CPSCT039View
9Almond-NL-F1-2010G6N/A3.06CPSCT039-B2View
Alignments
Feature NameTypeLocationAnalysis
scaffold_4 supercontig scaffold_4:420318..420916. Prunus persica Whole Genome v1.0 Assembly & Annotation
Pp04 chromosome Pp04:420298..420896+ Prunus persica Whole Genome Assembly v2.0 & Annotation v2.1 (v2.0.a1)