EPPCU0027, EPPCU0027 (genetic_marker) Prunus persica

Marker Overview
NameEPPCU0027
Genbank IDBU040027
TypeEST-SSR
SpeciesPrunus persica
Source TypeEST
PCR Condition94 C 5 min, 94 C 1 min, 55 C 1 min, 72 C 2 min. 35 cycles, 72 C 7min
Primer 1EPPCU0027.F primer: GCTATTTCTCGGTCGCTTCC
Primer 2EPPCU0027.R primer: CAATTCAATCAAGGCGATGG
Product Length155
Publication[view all]
ContactP. Arus
Contact
NameDetails
P. Arus
First name:Pere
Last name:Arus
Institution:IRTA
Address:Institut de Recerca I Tecnologia Agroalimentaries (IRTA), Departament de Genetica Vegetal, Carretera de Cabrils s/n, 08348 Cabrils, Spain
Email:pere.arus@irta.es
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
R primerEPPCU0027.R primerPrunus persicaprimer
F primerEPPCU0027.F primerPrunus persicaprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
EPPCU0027EPPCU0027Prunus persicamarker_locus


Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Markers Database2004-01-01
Alignment of genetic markers to Prunus persics v2.02019-04-11
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Prunus Bin MapLG1N/A0EPPCU0027View
2Apricot-LL-F2-Lito-2011LG1N/A29.3EPPCU0027View
3Apricot-integrated-Goldrich-2011LG1N/A25.3EPPCU0027View
4Prunus-TxE-peachV2.0LG1N/A0EPPCU0027View
Alignments
Feature NameTypeLocationAnalysis
scaffold_1 supercontig scaffold_1:9510868..9512871. Prunus persica Whole Genome v1.0 Assembly & Annotation
Pp01 chromosome Pp01:9960225..9962228+ Prunus persica Whole Genome Assembly v2.0 & Annotation v2.1 (v2.0.a1)