|
Marker Overview
Name | EPPCU1589 |
Genbank ID | BU041589 |
Type | EST-SSR |
Species | Prunus persica |
Source Type | EST |
PCR Condition | 94 C 2 min, 94 C 25 sec, 57 C 20 sec, 72 C 20 sec. 35 cycles, 72 C 5min |
Primer 1 | EPPCU1589.F primer: AAGTTCTTCGCCCATCTCAA |
Primer 2 | EPPCU1589.R primer: AGCAGCCGGGCTAATGAT |
Product Length | 166 |
Publication | [view all] |
Contact | P. Arus Amy Iezzoni
|
Analyses
This genetic_marker is derived from or has results from the following analyses
Publications
Year | Publication |
2005 | Howad W, Yamamoto T, Dirlewanger E, Testolin R, Cosson P, Cipriani G, Monforte AJ, Georgi L, Abbott AG, Arús P. Mapping with a few plants: using selective mapping for microsatellite saturation of the Prunus reference map. 2005 Nov; 171(3):1305-1309. |
2008 | Olmstead JW, Sebolt AM, Cabrera A, Sooriyapathirana SS, Hammar S, Iriarte G, Wang D, Chen CY, van der Knaap E, Iezzoni AF. Construction of an intra-specific sweet cherry (Prunus avium L.) genetic linkage map and synteny analysis with the Prunus reference map. Tree Genetics and Genomes. 2008; 4(4):897-910. |
|