EPPCU5176, EPPCU5176 (genetic_marker) Prunus persica

Marker Overview
NameEPPCU5176
Genbank IDBU045176
TypeSSR
SpeciesPrunus persica
Source TypeEST
PCR Condition94 C 5 min, 94 C 1 min, 55 C 1 min, 72 C 2 min. 35 cycles, 72 C 7min
Primer 1EPPCU5176.F primer: ATGACCACACAGAATCACCC
Primer 2EPPCU5176.R primer: GATCCTCAGCCCGAGTCAAT
Product Length171
Publication[view all]
ContactP. Arus
Contact
NameDetails
P. Arus
First name:Pere
Last name:Arus
Institution:IRTA
Address:Institut de Recerca I Tecnologia Agroalimentaries (IRTA), Departament de Genetica Vegetal, Carretera de Cabrils s/n, 08348 Cabrils, Spain
Email:pere.arus@irta.es
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
R primerEPPCU5176.R primerPrunus persicaprimer
F primerEPPCU5176.F primerPrunus persicaprimer


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
resistance to Monilinia fructicolaqRMF.CxEL-LG7.2009.Sk-rd.2Prunus persicaQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
EPPCU5176EPPCU5176Prunus persicamarker_locus
EPPCU5176EPPCU5176-50Prunus persicamarker_locus


Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Markers Database2004-01-01
Alignment of genetic markers to Prunus persics v2.02019-04-11
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Peach-DG-F1-2009G7N/A77.6EPPCU5176View
2Peach_CxEL_F1-physical-Prunus-persicaV1.0CxEL7N/A18772878EPPCU5176View
3Prunus-TE-F2-20157N/A47EPPCU5176View
4Prunus-TE-BC1-EG7_EN/A54EPPCU5176View
5Prunus Bin MapLG7N/A49EPPCU5176View
6Prunus-TxE-peachV2.0LG7N/A49EPPCU5176View
7Peach-Nectaross-F1G7N/A0EPPCU5176View
8Peach_Consensus_map_20187N/A50EPPCU5176View
Alignments
Feature NameTypeLocationAnalysis
scaffold_7 supercontig scaffold_7:18772878..18773417. Prunus persica Whole Genome v1.0 Assembly & Annotation
Pp07 chromosome Pp07:18371394..18371933+ Prunus persica Whole Genome Assembly v2.0 & Annotation v2.1 (v2.0.a1)