EPPCU9268, EPPCU9268 (genetic_marker) Prunus persica

Marker Overview
NameEPPCU9268
Genbank IDBU039268
TypeEST-SSR
SpeciesPrunus persica
Source TypeEST
PCR Condition94 C 2 min, 94 C 25 sec, 60 C 20 sec, 72 C 20 sec. 35 cycles, 72 C 5min
Primer 1EPPCU9268.F primer: CTCCGTCCCACCCTAAAAAT
Primer 2EPPCU9268.R primer: ACAATGACGAAACCGAGGAG
Product Length195
Publication[view all]
ContactP. Arus
Contact
NameDetails
P. Arus
First name:Pere
Last name:Arus
Institution:IRTA
Address:Institut de Recerca I Tecnologia Agroalimentaries (IRTA), Departament de Genetica Vegetal, Carretera de Cabrils s/n, 08348 Cabrils, Spain
Email:pere.arus@irta.es
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
R primerEPPCU9268.R primerPrunus persicaprimer
F primerEPPCU9268.F primerPrunus persicaprimer


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
resistance to Monilinia fructicolaqRMF.CxEL-LG3.2010.Fl-rdPrunus persicaQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
EPPCU9268EPPCU9268Prunus persicamarker_locus


Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Markers Database2004-01-01
Alignment of genetic markers to Prunus persics v2.02019-04-11
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Prunus Bin MapLG4N/A34.1EPPCU9268View
2Peach_CxEL_F1CxEL4N/A53.8EPPCU9268View
3Peach_CxEL_F1-physical-Prunus-persicaV1.0CxEL4N/A10830104EPPCU9268View
4Prunus-TxE-peachV2.0LG4N/A34.1EPPCU9268View
Alignments
Feature NameTypeLocationAnalysis
scaffold_4 supercontig scaffold_4:10830104..10831771. Prunus persica Whole Genome v1.0 Assembly & Annotation
Pp04 chromosome Pp04:10841094..10842761+ Prunus persica Whole Genome Assembly v2.0 & Annotation v2.1 (v2.0.a1)