|
Marker Overview
Name | GD103 |
Genbank ID | N/A |
Type | SSR |
Species | Malus x domestica |
Repeat Motif | (GA)20 |
PCR Condition | Two multiplexed primer sets, GD 12, 15 and 96 and GD100 and 103, were amplified in 25-microliter mixtures containing 25 ng of genomic DNA, 10-45 pmol of each primer, 0.20 mM of dNTPs, 2.0 mM MgSO4, 1 X buffer, and 0.25 units of polymerase. The multiplexed primer set GD142, 147 and 162 was amplified in a 20-microliter mixture containing 30 ng of genomic DNA, 20 pmols of each primer pair, same as above for dNTPs and MgSO4, 1 X buffer and 0.20 units polymerase. Multiplex primer set GD 142, 147 and 162 was amplified using a touchdown. Initially, 2 min at 94 degree followed by 2 cycles of 94C for 60 s, 65C 30 s, and 72C for 45s. The following 18 cycles had an annealing temp reduced by 1 degree per 2 cycles. The last 5 cycles maintained the 55C annealing temperature. The multiplex primer sets GD 12, GD 15, GD 96 and GD 100 and GD 103 were amplified following a 4-min denaturation at 94C . Reaction conditions were 25 cycles at 94C for 60s, 55C for 120s, 72C for 120s and a 10m extension at 72C. |
Primer 1 | GD103.F: CGGCGAGAAAAAAAAACAATG |
Primer 2 | GD103.R: GGATAACCGTCCCCCTCTTC |
Product Length | 90-133 |
Max Length | 133 |
Publication | [view all] |
Contact | S. Hokanson
|
Publications
Year | Publication |
1998 | Hokanson SC, Szewc-McFadden AK, Lamboy WF, McFerson JR. Microsatellite (SSR) markers reveal genetic identities, genetic diversity and relationships in a Malus x domestica borkh. core subset collection. Theoretical and Applied Genetics. 1998; 97:671-683. |
2005 | J. Amer. Soc. Hort. Sci. 130:203-210 |
2012 | Schouten HJ, van de Weg WE, Carling J, Khan SI, McKay SJ, van Kaauwen MPW, Wittenberg AHJ, Koehorst-van Putten HJJ, Noordijk Y, Gao Z, Rees DJG, Van Dyk MM, Jaccoud D, Considine MJ, Kilian A. Diversity arrays technology (DArT) markers in apple for genetic linkage maps. Molecular breeding 2012 29:645–660 |
2012 | Antanaviciute L, Fernández-Fernández F, Jansen J, Banchi E, Evans KM, Viola R, Velasco R, Dunwell JM, Troggio M, Sargent DJ. Development of a dense SNP-based linkage map of an apple rootstock progeny using the Malus Infinium whole genome genotyping array. BMC genomics. 2012; 13:203. |
|