GD147 (genetic_marker) Malus domestica

Marker Overview
NameGD147
Genbank IDN/A
TypeSSR
SpeciesMalus x domestica
Repeat Motif(AG)7
PCR ConditionTwo multiplexed primer sets, GD 12, 15 and 96 and GD100 and 103, were amplified in 25-microliter mixtures containing 25 ng of genomic DNA, 10-45 pmol of each primer, 0.20 mM of dNTPs, 2.0 mM MgSO4, 1 X buffer, and 0.25 units of polymerase. The multiplexed primer set GD142, 147 and 162 was amplified in a 20-microliter mixture containing 30 ng of genomic DNA, 20 pmols of each primer pair, same as above for dNTPs and MgSO4, 1 X buffer and 0.20 units polymerase. Multiplex primer set GD 142, 147 and 162 was amplified using a touchdown. Initially, 2 min at 94 degree followed by 2 cycles of 94C for 60 s, 65C 30 s, and 72C for 45s. The following 18 cycles had an annealing temp reduced by 1 degree per 2 cycles. The last 5 cycles maintained the 55C annealing temperature. The multiplex primer sets GD 12, GD 15, GD 96 and GD 100 and GD 103 were amplified following a 4-min denaturation at 94C . Reaction conditions were 25 cycles at 94C for 60s, 55C for 120s, 72C for 120s and a 10m extension at 72C.
Primer 1GD147.F: TCCCGCCATTTCTCTGC
Primer 2GD147.R: GTTTAAACCGCTGCTGCTGAAC
Product Length124-156
Max Length156
PolymorphismP_ GD147
Publication[view all]
ContactS. Hokanson
Andreas Peil
Miyuki Kunihisa
Andrea Patocchi
Publications
YearPublication
1998Hokanson SC, Szewc-McFadden AK, Lamboy WF, McFerson JR. Microsatellite (SSR) markers reveal genetic identities, genetic diversity and relationships in a Malus x domestica borkh. core subset collection. Theoretical and Applied Genetics. 1998; 97:671-683.
2005J. Amer. Soc. Hort. Sci. 130:203-210
2008J. Amer. Soc. Hort. Sci. 133:1-7.
2006J. Amer. Soc. Hort. Sci. 131:408-417
2014Wöhner TW, Flachowsky H, Richter K, Garcia-Libreros T, Trognitz F, Hanke M, Peil A. QTL mapping of fire blight resistance in Malus ×robusta 5 after inoculation with different strains of Erwinia amylovora. Molecular breeding. 2014; 34(1):217-230.
2014Emeriewen O, Richter K, Kilian A, Zini E, Hanke M, Malnoy M, Peil A. Identification of a major quantitative trait locus for resistance to fire blight in the wild apple species Malus fusca. Molecular breeding. 2014; 34(2):407-419.
2010Velasco R, Zharkikh A, Affourtit J, Dhingra A, Cestaro A, Kalyanaraman A, Fontana P, Bhatnagar SK, Troggio M, Pruss D, Salvi S, Pindo M, Baldi P, Castelletti S, Cavaiuolo M, Coppola G, Costa F, Cova V, Dal Ri A, Goremykin V, Komjanc M, Longhi S, Magnago P, Malacarne G, Malnoy M, Micheletti D, Moretto M, Perazzolli M, Si-Ammour A, Vezzulli S, Zini E, Eldredge G, Fitzgerald LM, Gutin N, Lanchbury J, Macalma T, Mitchell JT, Reid J, Wardell B, Kodira C, Chen Z, Desany B, Niazi F, Palmer M, Koepke T, Jiwan D, Schaeffer S, Krishnan V, Wu C, Chu VT, King ST, Vick J, Tao Q, Mraz A, Stormo A, Stormo K, Bogden R, Ederle D, Stella A, Vecchietti A, Kater MM, Masiero S, Lasserre P, Lespinasse Y, Allan AC, Bus V, Chagné D, Crowhurst RN, Gleave AP, Lavezzo E, Fawcett JA, Proost S, Rouzé P, Sterck L, Toppo S, Lazzari B, Hellens RP, Durel CE, Gutin A, Bumgarner RE, Gardiner SE, Skolnick M, Egholm M, Van de Peer Y, Salamini F, Viola R. The genome of the domesticated apple (Malus x domestica Borkh.). Nature Genetics. 2010 Oct; 42(10):833-839.
2006Silfverberg-Dilworth E, Matasci CL, Van de Weg WE, Van Kaauwen MPW, Walser M, Kodde LP, Soglio V, Gianfranceschi L, Durel CE, Costa F, Yamamoto T, Koller B, Gessler C Patocchi A. Microsatellite markers spanning the apple (Malus x domestica Borkh.) genome. Tree Genetics and Genomes. 2006; 2(4):202-224.
2012Schouten HJ, van de Weg WE, Carling J, Khan SI, McKay SJ, van Kaauwen MPW, Wittenberg AHJ, Koehorst-van Putten HJJ, Noordijk Y, Gao Z, Rees DJG, Van Dyk MM, Jaccoud D, Considine MJ, Kilian A. Diversity arrays technology (DArT) markers in apple for genetic linkage maps. Molecular breeding 2012 29:645–660
2012Antanaviciute L, Fernández-Fernández F, Jansen J, Banchi E, Evans KM, Viola R, Velasco R, Dunwell JM, Troggio M, Sargent DJ. Development of a dense SNP-based linkage map of an apple rootstock progeny using the Malus Infinium whole genome genotyping array. BMC genomics. 2012; 13:203.
2014Kunihisa M, Moriya S, Abe K, Okada K, Haji T, Hayashi T, Kim H, Nishitani C, Terakami S, Yamamoto T. Identification of QTLs for fruit quality traits in Japanese apples: QTLs for early ripening are tightly related to preharvest fruit drop. Breeding science. 2014 Sep; 64(3):240-51.
Contact
NameDetails
S. Hokanson
First name:Stan
Last name:Hokanson
Institution:University of Minnesota
Address:Department of Horticultural Science, 1970 Folwell Avenue, St. Paul, MN 55108
Country:United States
Email:hokan017@umn.edu
Phone:16126241203
Fax:(301)504-5062
Last update:Apr 1998
Andreas Peil
First name:Andreas
Last name:Peil
Title:Researcher
Institution:Institute for Breeding Research on Fruit
Address:Kulius Kuhn-Institut (JKI), Pillnitzer Platz 3a, 01326
Country:Dresden, Germany
Email:andreas.peil@jki.bund.de
Miyuki Kunihisa
First name:Miyuki
Last name:Kunihisa
Institution:NARO Institute of Fruit Tree Science
Address:2-1 Fujimoto, Tsukuba, Ibaraki 305-8605
Country:Japan
Email:miyuky@affrc.go.jp
Phone:81-29-838-6437
Keywords:fruit drop
Andrea Patocchi
First name:Andrea
Last name:Patocchi
Title:researcher
Institution:Plant Pathology, Institute of Integrative Biology (IBZ)
Address:ETH Zurich, CH-8092 Zurich, Switzerland
Country:Switzerland
Email:andrea.patocchi@agrl.ethz.ch
Keywords:SSR
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
FGD147.FMalus x domesticaprimer
RGD147.RMalus x domesticaprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
GD147GD147Malus x domesticamarker_locus
GD147GD147-35.2Malus x domesticamarker_locus
GD147GD147-34.4Malus x domesticamarker_locus
GD147GD147-11.9Malus x domesticamarker_locus
GD147GD147-77.544Malus x domesticamarker_locus
GD147GD147-11.438Malus x domesticamarker_locus
GD147GD147-46.65Malus x domesticamarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-FD-F1-2006D13N/A45.1GD147View
2Apple Integrated map13N/A36.3GD147View
3Apple-IM-F1-IdaredIda LG 13N/A29.9GD147View
4Apple-IM-F1-Mr5Mr5 LG 13N/A24GD147View
5Apple-MAL0045_x_Idared-F1-MfuscaLG13AN/A26.5GD147View
6Apple-PF-F1-2012ch13N/A21GD147View
7Apple-MM-F113N/A30GD147View
8Apple-OA-F1-AkaneAK13N/A22GD147View
9Apple-M432-2012LG13N/A14.5GD147View
10Apple-RGTxGD-F1-2015RGT_13N/A29.11GD147View
11Apple-JM7xS63-F1J13N/A35.2GD147View
12Apple-JM7xS63-F1J13N/A35.2GD147View
13Apple-JM7xS63-F1S13N/A34.4GD147View
14Pear-BD-F1-2015LG13N/A11.9GD147View
15Pear-Bayuehong-F1-2015LG13N/A77.54GD147View
16Pear-Dangshansuli-F1-2015LG13N/A11.44GD147View
17Pear-integrated_consensus_map-IPCG-2017LG13N/A46.65GD147View