GD96 (genetic_marker) Malus domestica

Marker Overview
NameGD96
Genbank IDN/A
TypeSSR
SpeciesMalus x domestica
Repeat Motif(TC)22
PCR ConditionTwo multiplexed primer sets, GD 12, 15 and 96 and GD100 and 103, were amplified in 25-microliter mixtures containing 25 ng of genomic DNA, 10-45 pmol of each primer, 0.20 mM of dNTPs, 2.0 mM MgSO4, 1 X buffer, and 0.25 units of polymerase. The multiplexed primer set GD142, 147 and 162 was amplified in a 20-microliter mixture containing 30 ng of genomic DNA, 20 pmols of each primer pair, same as above for dNTPs and MgSO4, 1 X buffer and 0.20 units polymerase. Multiplex primer set GD 142, 147 and 162 was amplified using a touchdown. Initially, 2 min at 94 degree followed by 2 cycles of 94C for 60 s, 65C 30 s, and 72C for 45s. The following 18 cycles had an annealing temp reduced by 1 degree per 2 cycles. The last 5 cycles maintained the 55C annealing temperature. The multiplex primer sets GD 12, GD 15, GD 96 and GD 100 and GD 103 were amplified following a 4-min denaturation at 94C . Reaction conditions were 25 cycles at 94C for 60s, 55C for 120s, 72C for 120s and a 10m extension at 72C.
Primer 1GD96.F: CGGCGGAAAGCAATCACCT
Primer 2GD96.R: GCCAGCCCTCTATGGTTCCAGA
Product Length152-197
Max Length197
PolymorphismP_ GD96
Publication[view all]
ContactS. Hokanson
Andreas Peil
Contact
NameDetails
S. Hokanson
First name:Stan
Last name:Hokanson
Institution:University of Minnesota
Address:Department of Horticultural Science, 1970 Folwell Avenue, St. Paul, MN 55108
Country:United States
Email:hokan017@umn.edu
Phone:16126241203
Fax:(301)504-5062
Last update:Apr 1998
Andreas Peil
First name:Andreas
Last name:Peil
Title:Researcher
Institution:Institute for Breeding Research on Fruit
Address:Kulius Kuhn-Institut (JKI), Pillnitzer Platz 3a, 01326
Country:Dresden, Germany
Email:andreas.peil@jki.bund.de
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
FGD96.FMalus x domesticaprimer
RGD96.RMalus x domesticaprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
GD96GD96Malus x domesticamarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-IM-F1-IdaredIda LG 17N/A29.9GD96View
2Apple-IM-F1-Mr5Mr5 LG 17N/A47.4GD96View
3Apple-MM-F117N/A26.7GD96View
4Apple-M432-2012LG17N/A26.5GD96View
5Apple-RGTxGD-F1-2015RGT_17N/A23.54GD96View
6Apple-RGTxGD-F1-2015GD_17N/A47.13GD96View
7Apple-RGxPI6-F1LG17N/A43.4GD96View