M12a, M12a (genetic_marker) Prunus persica

Marker Overview
NameM12a
Genbank IDN/A
TypeSSR
SpeciesPrunus persica
GermplasmAkatsuki
Source TypecDNA
Repeat MotifAG
Primer 1M12a.F primer: AGGTGCCTCATCTTCTTCTCTTG
Primer 2M12a.R primer: GTGTGGTGAGGGGTGAGAGC
Product Length176
PolymorphismP_ M12a
Publication[view all]
ContactT. Yamamoto
Contact
NameDetails
T. Yamamoto
First name:Toshiya
Last name:Yamamoto
Title:researcher
Institution:National Institute of Fruit Tree Science, Japan
Address:National Institute of Fruit Tree Science Fujimoto 2-1, Tsukuba Ibaraki 305-8605, Japan
Email:toshiya@affrc.go.jp
Phone:81-29-838-6474,6491
Keywords:Pyrus pyrifolia
Relationships

This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
chilling requirementqCR.2.CxF-G4b.2009.2014Prunus persicaQTL
chilling requirementqCR.27.2.CxF-G4b.2009Prunus persicaQTL
chilling requirementqCR.CxF-G1a.2009Prunus persicaQTL
chilling requirementqCR.2.CxF-G4b.2009Prunus persicaQTL
chilling requirementqCR.CxF-G1a.2009.2Prunus persicaQTL
resistance to Monilinia fructicolaqRMF.CxEL-LG4.2010.Sk-if.1Prunus persicaQTL


This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
R primerM12a.R primerPrunus persicaprimer
F primerM12a.F primerPrunus persicaprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
M12M12Prunus persicamarker_locus
nM12anM12aPrunus persicamarker_locus
M12aM12a-38.78Prunus persicamarker_locus


Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Markers Database2004-01-01
Alignment of genetic markers to Prunus persics v2.02019-04-11
Germplasm
Stock NameType
Akatsukicultivar
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Peach_CxEL_F1CxEL4N/A39.2M12View
2Sweet Cherry-PAxPN-94G4N/A47.6nM12aView
3Sweet Cherry-47G4N/A54.2nM12aView
4Peach_Consensus_map_20184N/A38.78M12aView
Alignments
Feature NameTypeLocationAnalysis
scaffold_4 supercontig scaffold_4:9208608..9209944. Prunus persica Whole Genome v1.0 Assembly & Annotation
Pp04 chromosome Pp04:9219594..9220930+ Prunus persica Whole Genome Assembly v2.0 & Annotation v2.1 (v2.0.a1)