|
|
Marker Overview
| Name | MA061a |
|---|
| Genbank ID | AB206853 |
|---|
| Type | SSR |
|---|
| Species | Prunus persica |
|---|
| Germplasm | Akatsuki |
|---|
| Source Type | genomic DNA |
|---|
| PCR Condition | 94 C 5 min, 94 C 1 min, 55 C 1 min, 72 C 2 min. 35 cycles, 72 C 7min |
|---|
| Primer 1 | MA061a.F primer: ACCAAAAAGCCAAGTCGAACA |
|---|
| Primer 2 | MA061a.R primer: CGTTTTCTTCTAGGGCAGTTCA |
|---|
| Publication | [view all] |
|---|
| Contact | T. Yamamoto
Amy Iezzoni
|
|---|
Analyses
This genetic_marker is derived from or has results from the following analyses
Publications
| Year | Publication |
|---|
| 2005 | Yamamoto T, Yamaguchi M, Hayashi T. An Integrated Genetic Linkage Map of Peach by SSR, STS, AFLP and RAPD. Journal of the Japanese Society for Horticultural Science. 2005; 74(3):204-213. |
| 2008 | Olmstead JW, Sebolt AM, Cabrera A, Sooriyapathirana SS, Hammar S, Iriarte G, Wang D, Chen CY, van der Knaap E, Iezzoni AF. Construction of an intra-specific sweet cherry (Prunus avium L.) genetic linkage map and synteny analysis with the Prunus reference map. Tree Genetics and Genomes. 2008; 4(4):897-910. |
|
