|
|
Marker Overview
| Name | pchgms1 |
|---|
| Genbank ID | N/A |
|---|
| Type | SSR |
|---|
| Species | Prunus persica |
|---|
| Germplasm | Bicentennial |
|---|
| Source Type | genomic DNA
genomic |
|---|
| Repeat Motif | (AC)12(AT)6 |
|---|
| Primer 1 | pchgms1.F primer: GGG TAA ATA TGC CCA TTG TGC AAT C |
|---|
| Primer 2 | pchgms1.Forward Primer: GGGTAAATATGCCCATTGTGCAATC |
|---|
| Primer 3 | pchgms1.R primer: GGA TCA TTG AAC TAC GTC AAT CCT C |
|---|
| Primer 4 | pchgms1.Reverse Primer: GGATCATTGAACTACGTCAATCCTC |
|---|
| Product Length | 194 |
|---|
| Publication | [view all] |
|---|
| Contact | A. Abbott
Amy Iezzoni
Maria Badenes
|
|---|
Analyses
This genetic_marker is derived from or has results from the following analyses
Publications
| Year | Publication |
|---|
| 2000 | Theoretical and applied genetics. Theor. appl. genet. Aug 2000. v. 101 (3) p. 421-428. ISSN 0040-5752; THAGA6 |
| 2005 | Yamamoto T, Yamaguchi M, Hayashi T. An Integrated Genetic Linkage Map of Peach by SSR, STS, AFLP and RAPD. Journal of the Japanese Society for Horticultural Science. 2005; 74(3):204-213. |
| 2005 | Gillen AM, Bliss FA. Identification and mapping of markers linked to the Mi gene for root-knot nematode resistance in peach. Journal of the American Society for Horticultural Science. 2005; 130(1):24-33. |
| 2008 | Olmstead JW, Sebolt AM, Cabrera A, Sooriyapathirana SS, Hammar S, Iriarte G, Wang D, Chen CY, van der Knaap E, Iezzoni AF. Construction of an intra-specific sweet cherry (Prunus avium L.) genetic linkage map and synteny analysis with the Prunus reference map. Tree Genetics and Genomes. 2008; 4(4):897-910. |
| 2000 | B. Sosinski, M. Gannavarapu, L. D. Hager, L. E. Beck, G.J. King, C. D. Ryder, S. Rajapakse, W. V. Baird, R. E. Ballard, A. G. Abbott. Characterization of microsatellite markers in peach [Prunus persica (L.) Batsch] Theoretical and Applied Genetics 2000 101 (3):421-428. |
|
