pms67 (genetic_marker) Prunus cerasus | GDR

Marker Overview

Marker Overview


Name	pms67
Genbank ID	N/A
Type	SSR
Species	Prunus cerasus
Germplasm	Valerij Tschkalov
Source Type	Genomic DNA
Repeat Motif	CT, CA and GA
Primer 1	pms67.Forward Primer: AGTCTCTCACAGTCAGTTTCT
Primer 2	pms67.Reverse Primer: TTAACTTAACCCCTCTCCCTCC
Publication	[view all]
Contact	C. Cantini Amy Iezzoni Maria Badenes

Contact

Name

Details

C. Cantini

First name:	C.
Last name:	Cantini

Amy Iezzoni

First name:	Amy
Last name:	Iezzoni
Title:	Professor
Institution:	Michigan State University
Address:	A342 PSSB, East Lansing, MI 48824
Country:	USA
Email:	iezzoni@msu.edu
Phone:	517-355-5191 x1391
Keywords:	cherry breeder
Last update:	Jun 2017

Maria Badenes

First name:	Maria
Last name:	Badenes
Institution:	Instituto Valenciano de Investigaciones Agrarias (IVIA)
Address:	Instituto Valenciano de Investigaciones Agrarias, Apartado Oficial 46113 Moncada, Valencia, Spain
Country:	Spain
Email:	badenes_mlu@gva.es

Publications


Year	Publication
2005	Yamamoto T, Yamaguchi M, Hayashi T. An Integrated Genetic Linkage Map of Peach by SSR, STS, AFLP and RAPD. Journal of the Japanese Society for Horticultural Science. 2005; 74(3):204-213.
2008	Olmstead JW, Sebolt AM, Cabrera A, Sooriyapathirana SS, Hammar S, Iriarte G, Wang D, Chen CY, van der Knaap E, Iezzoni AF. Construction of an intra-specific sweet cherry (Prunus avium L.) genetic linkage map and synteny analysis with the Prunus reference map. Tree Genetics and Genomes. 2008; 4(4):897-910.
2001	American Society for Horticultural Science. Journal of the American Society for Horticultural Science. J. Am. Soc. Hortic. Sci. Mar 2001. v. 126 (2) p. 205-209. ISSN 0003-1062

Germplasm


Stock Name	Type
Valerij Tschkalov	accession

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Peach-JF-F2	G1	N/A	92.3	pms67	View
2	Prunus-TE-F2	G1	N/A	45.9	pms67	View
3	Peach-AJ-F2-2005	G1	N/A	48	pms67	View
4	Peach-AJ-F2	G1	N/A	48	pms67	View
5	Sweet Cherry-EFxNY-F1-2008	EF1	N/A	84.55	pms67	View
6	Peach-LAxFG-F2	LG1	N/A	3.3	pms67	View
7	Peach-PIxSL-F2	LG1	N/A	4.7	pms67	View
8	Sweet Cherry-C-303xBeniyutaka-F1	Pa1	N/A	117.99	pms67	View
9	Sweet Cherry-C-303xBenikirari-F1	Pa1	N/A	55.44	pms67	View
10	Sweet Cherry-C-309xC-195-50-F1	Pa1	N/A	56.34	pms67	View
11	Sweet Cherry-C-309xBenikirari-F1	Pa1	N/A	89.3	pms67	View
12	Sweet Cherry-PAV_r1.0_consensus_map-F1	Pa1	N/A	69.56	pms67	View
13	Chokecherry-RCxSC-F1-2014	SC III	N/A	41.4	PMS67-1	View
14	Chokecherry-RCxSC-F1-2017	Cho-3	N/A	123.76	PMS67-1	View
15	Chokecherry-RCxSC-F1-2014	SC XIIb	N/A	40.9	PMS67-3	View
16	Chokecherry-RCxSC-F1-2017	Cho-8	N/A	85.69	PMS67-3	View
17	Sweet Cherry-PAxPN-94	G1	N/A	95.1	aPMS67	View