snp_4_23038297, snp_4_23038297 (genetic_marker) Prunus persica

Marker Overview
Namesnp_4_23038297
dbSNP IDN/A
SNP Array ID
IRSC 9K SNP array for peach:snp_4_23038297
IRSC 16K SNP array for peach:snp_4_23038297
3K SeqSNP for peach:snp_4_23038297
TypeSNP
SNP Alleles[T/C]
SpeciesPrunus persica
Primer 1snp_4_23038297_LEFT_primer_0: AGCAGACCCAAAGGAATTTACA
Primer 2snp_4_23038297_RIGHT_primer_0: ACATGCTTGTAGGGAATAGGGA
Product Length224
ContactKsenija Gasic
Contact
NameDetails
Ksenija Gasic
Description:fruit quality, abiotic and biotic tolerance /resistance
First name:Ksenija
Last name:Gasic
Title:Assistant professor
Institution:Clemson University
Address:112 BRC/ 51 New Cherry Rd, Clemson Sc 29634
Country:USA
Email:kgasic@clemson.edu
Phone:864.656.3664.
Fax:864-656-4960
Keywords:Traditional and molecular plant breeding
Libraries
Library NameType
IRSC 9K SNP array for peachSNP_chip
IRSC 16K SNP array for peachSNP_chip
3K SeqSNP for peachSNP_chip
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
snp_4_23038297_LEFT_primer_0snp_4_23038297_LEFT_primer_0Prunus persicaprimer
snp_4_23038297_RIGHT_primer_0snp_4_23038297_RIGHT_primer_0Prunus persicaprimer


This genetic_marker is adjacent to the following heritable_phenotypic_marker feature(s):

Feature NameUnique NameSpeciesType
flesh adhesionflesh adhesion-FPrunus persicaheritable_phenotypic_marker


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
snp_4_23038297snp_4_23038297Prunus persicamarker_locus
S4_23038297S4_23038297Prunus persicamarker_locus


Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Alignment of IRSC SNP array 9K to Peach Genome v2.0.a12016-11-21
Prunus persica Whole Genome Assembly v2.0 & Annotation v2.1 (v2.0.a1)2015-01-15
Sequence
>snp_4_23038297 ID=snp_4_23038297|Name=snp_4_23038297|organism=Prunus persica|type=genetic_marker|length=203bp
TTCCCTGTAACAGGTTGGATGTAACAAAAATTCTTAGATTAAAAATAACC
CCAAAAAAAATCACAAATTTAATACGATTTCATTATGCGTATATAATTTT
CRTTGAGCTGCTTTTTAATCTCAAAGGAGGAGAAAAAAATAATATTTTCA
TTCAATATCTATCCCTATTCCCTACAAGCATGTAAAACATCTTAACATTC
CAA
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Peach-BO-F1LG4_BN/A54.1snp_4_23038297View
2Peach-PF-Recurrent-2017LG4N/A43.8snp_4_23038297View
3Peach-Nectaross-F1G4N/A39.9snp_4_23038297View
4Prunus-TE-F2-20154N/A46.5S4_23038297View
Alignments
Feature NameTypeLocationAnalysis
scaffold_4 supercontig scaffold_4:23038297..23038297. Prunus persica Whole Genome v1.0 Assembly & Annotation
Pp04 chromosome Pp04:19435125..19435125. Prunus persica Whole Genome Assembly v2.0 & Annotation v2.1 (v2.0.a1)