snp_6_2750075, snp_6_2750075 (genetic_marker) Prunus persica

Marker Overview
Namesnp_6_2750075
dbSNP IDN/A
SNP Array ID
IRSC 9K SNP array for peach:snp_6_2750075
IRSC 16K SNP array for peach:snp_6_2750075
3K SeqSNP for peach:snp_6_2750075
TypeSNP
SNP Alleles[T/C]
SpeciesPrunus persica
Primer 1snp_6_2750075_LEFT_primer_0: TGATGCACACATTTACTCTCCC
Primer 2snp_6_2750075_RIGHT_primer_0: CAACCTGCACATTTTTACTTGC
Product Length279
ContactKsenija Gasic
Associated WithGWAS0001003
Contact
NameDetails
Ksenija Gasic
Description:fruit quality, abiotic and biotic tolerance /resistance
First name:Ksenija
Last name:Gasic
Title:Assistant professor
Institution:Clemson University
Address:112 BRC/ 51 New Cherry Rd, Clemson Sc 29634
Country:USA
Email:kgasic@clemson.edu
Phone:864.656.3664.
Fax:864-656-4960
Keywords:Traditional and molecular plant breeding
Libraries
Library NameType
IRSC 9K SNP array for peachSNP_chip
IRSC 16K SNP array for peachSNP_chip
3K SeqSNP for peachSNP_chip
Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Alignment of IRSC SNP array 9K to Peach Genome v2.0.a12016-11-21
Prunus persica Whole Genome Assembly v2.0 & Annotation v2.1 (v2.0.a1)2015-01-15
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1peach-ZC-F26N/A4.08snp_6_2750075View
2Peach-Armking-F1G6N/A13.1snp_6_2750075View
3Peach-RosBREED-4K-20196N/A9.83snp_6_2750075View
4Peach-ZC-F2-20186N/A2.93snp_6_2750075View
Sequence
>snp_6_2750075 ID=snp_6_2750075; Name=snp_6_2750075; organism=Prunus persica; type=genetic_marker; length=203bp
AATTGGAACGATATAAAACCACAATTCCCCTACATTTTCCAAAACTCAAA
TGCCCCATTTCATTTCACAAAATTCTCCCCAGATCTCTCAGAGAGGAGTC
TYTTGATTTTTTGGGTCTCAAAGCAAGTAAAAATGTGCAGGTTGTGCGTG
TGCTGCATGTGCATATTAGTAATCTTGCTATTCATCGGGGTGTTATTTGC
GGT
Alignments
Feature NameTypeLocationAnalysis
scaffold_6 supercontig scaffold_6:2750075..2750075. Prunus persica Whole Genome v1.0 Assembly & Annotation
Pp06 chromosome Pp06:2458637..2458637. Prunus persica Whole Genome Assembly v2.0 & Annotation v2.1 (v2.0.a1)
Annotated Terms
The following terms have been associated with this genetic_marker:
Vocabulary: Rosaceae Trait Ontology
TermDefinition
MAIN:000192278fruit ripe 100%