SNP_IGA_131324, SNP_IGA_131324 (genetic_marker) Prunus persica

Marker Overview
NameSNP_IGA_131324
dbSNP IDN/A
SNP Array ID
IRSC 9K SNP array for peach:SNP_IGA_131324
IRSC 16K SNP array for peach:SNP_IGA_131324
3K SeqSNP for peach:SNP_IGA_131324
TypeSNP
SNP Alleles[T/C]
SpeciesPrunus persica
Primer 1SNP_IGA_131324_LEFT_primer_0: GATCAATCACATCATCAATGGG
Primer 2SNP_IGA_131324_RIGHT_primer_0: GGTGGATCACTTCAAGATGACA
Product Length202
ContactKsenija Gasic
Contact
NameDetails
Ksenija Gasic
Description:fruit quality, abiotic and biotic tolerance /resistance
First name:Ksenija
Last name:Gasic
Title:Assistant professor
Institution:Clemson University
Address:112 BRC/ 51 New Cherry Rd, Clemson Sc 29634
Country:USA
Email:kgasic@clemson.edu
Phone:864.656.3664.
Fax:864-656-4960
Keywords:Traditional and molecular plant breeding
Libraries
Library NameType
IRSC 9K SNP array for peachSNP_chip
IRSC 16K SNP array for peachSNP_chip
3K SeqSNP for peachSNP_chip
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
SNP_IGA_131324_LEFT_primer_0SNP_IGA_131324_LEFT_primer_0Prunus persicaprimer
SNP_IGA_131324_RIGHT_primer_0SNP_IGA_131324_RIGHT_primer_0Prunus persicaprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SNP_IGA_131324SNP_IGA_131324Prunus persicamarker_locus


The following haplotype_block feature(s) contains this genetic_marker:

Feature NameUnique NameSpeciesType
Ppe-HB-01-19Ppe-HB-01-19Prunus persicahaplotype_block


The following haplotype feature(s) contains this genetic_marker:

Feature NameUnique NameSpeciesType
8HB-01-19_8Prunus persicahaplotype
9HB-01-19_9Prunus persicahaplotype
10HB-01-19_10Prunus persicahaplotype
11HB-01-19_11Prunus persicahaplotype
12HB-01-19_12Prunus persicahaplotype
16HB-01-19_16Prunus persicahaplotype
17HB-01-19_17Prunus persicahaplotype
18HB-01-19_18Prunus persicahaplotype
19HB-01-19_19Prunus persicahaplotype
20HB-01-19_20Prunus persicahaplotype
21HB-01-19_21Prunus persicahaplotype
22HB-01-19_22Prunus persicahaplotype
27HB-01-19_27Prunus persicahaplotype
28HB-01-19_28Prunus persicahaplotype
29HB-01-19_29Prunus persicahaplotype
30HB-01-19_30Prunus persicahaplotype
31HB-01-19_31Prunus persicahaplotype
32HB-01-19_32Prunus persicahaplotype
34HB-01-19_34Prunus persicahaplotype
39HB-01-19_39Prunus persicahaplotype
40HB-01-19_40Prunus persicahaplotype
6HB-01-19_6Prunus persicahaplotype
7HB-01-19_7Prunus persicahaplotype
14HB-01-19_14Prunus persicahaplotype
23HB-01-19_23Prunus persicahaplotype
24HB-01-19_24Prunus persicahaplotype
36HB-01-19_36Prunus persicahaplotype
38HB-01-19_38Prunus persicahaplotype
4HB-01-19_4Prunus persicahaplotype
5HB-01-19_5Prunus persicahaplotype
13HB-01-19_13Prunus persicahaplotype
15HB-01-19_15Prunus persicahaplotype
25HB-01-19_25Prunus persicahaplotype
26HB-01-19_26Prunus persicahaplotype
37HB-01-19_37Prunus persicahaplotype
41HB-01-19_41Prunus persicahaplotype
43HB-01-19_43Prunus persicahaplotype
45HB-01-19_45Prunus persicahaplotype
46HB-01-19_46Prunus persicahaplotype
47HB-01-19_47Prunus persicahaplotype
50HB-01-19_50Prunus persicahaplotype
52HB-01-19_52Prunus persicahaplotype
56HB-01-19_56Prunus persicahaplotype
57HB-01-19_57Prunus persicahaplotype
58HB-01-19_58Prunus persicahaplotype
59HB-01-19_59Prunus persicahaplotype
60HB-01-19_60Prunus persicahaplotype
61HB-01-19_61Prunus persicahaplotype
62HB-01-19_62Prunus persicahaplotype
64HB-01-19_64Prunus persicahaplotype
65HB-01-19_65Prunus persicahaplotype
66HB-01-19_66Prunus persicahaplotype
67HB-01-19_67Prunus persicahaplotype
68HB-01-19_68Prunus persicahaplotype
69HB-01-19_69Prunus persicahaplotype
33HB-01-19_33Prunus persicahaplotype
42HB-01-19_42Prunus persicahaplotype
44HB-01-19_44Prunus persicahaplotype
2HB-01-19_2Prunus persicahaplotype
3HB-01-19_3Prunus persicahaplotype
35HB-01-19_35Prunus persicahaplotype
48HB-01-19_48Prunus persicahaplotype
51HB-01-19_51Prunus persicahaplotype
53HB-01-19_53Prunus persicahaplotype
54HB-01-19_54Prunus persicahaplotype
55HB-01-19_55Prunus persicahaplotype
49HB-01-19_49Prunus persicahaplotype
63HB-01-19_63Prunus persicahaplotype
71HB-01-19_71Prunus persicahaplotype
72HB-01-19_72Prunus persicahaplotype
74HB-01-19_74Prunus persicahaplotype
75HB-01-19_75Prunus persicahaplotype
77HB-01-19_77Prunus persicahaplotype
78HB-01-19_78Prunus persicahaplotype
79HB-01-19_79Prunus persicahaplotype
81HB-01-19_81Prunus persicahaplotype
70HB-01-19_70Prunus persicahaplotype
80HB-01-19_80Prunus persicahaplotype
82HB-01-19_82Prunus persicahaplotype
85HB-01-19_85Prunus persicahaplotype
86HB-01-19_86Prunus persicahaplotype
73HB-01-19_73Prunus persicahaplotype
76HB-01-19_76Prunus persicahaplotype
89HB-01-19_89Prunus persicahaplotype
90HB-01-19_90Prunus persicahaplotype
92HB-01-19_92Prunus persicahaplotype
84HB-01-19_84Prunus persicahaplotype
87HB-01-19_87Prunus persicahaplotype
88HB-01-19_88Prunus persicahaplotype
94HB-01-19_94Prunus persicahaplotype
95HB-01-19_95Prunus persicahaplotype
96HB-01-19_96Prunus persicahaplotype
99HB-01-19_99Prunus persicahaplotype
101HB-01-19_101Prunus persicahaplotype
102HB-01-19_102Prunus persicahaplotype
103HB-01-19_103Prunus persicahaplotype
104HB-01-19_104Prunus persicahaplotype
106HB-01-19_106Prunus persicahaplotype
110HB-01-19_110Prunus persicahaplotype
111HB-01-19_111Prunus persicahaplotype
112HB-01-19_112Prunus persicahaplotype
115HB-01-19_115Prunus persicahaplotype
116HB-01-19_116Prunus persicahaplotype
117HB-01-19_117Prunus persicahaplotype
118HB-01-19_118Prunus persicahaplotype
119HB-01-19_119Prunus persicahaplotype
120HB-01-19_120Prunus persicahaplotype
121HB-01-19_121Prunus persicahaplotype
83HB-01-19_83Prunus persicahaplotype
91HB-01-19_91Prunus persicahaplotype
93HB-01-19_93Prunus persicahaplotype
100HB-01-19_100Prunus persicahaplotype
107HB-01-19_107Prunus persicahaplotype
108HB-01-19_108Prunus persicahaplotype
109HB-01-19_109Prunus persicahaplotype
113HB-01-19_113Prunus persicahaplotype
125HB-01-19_125Prunus persicahaplotype
126HB-01-19_126Prunus persicahaplotype
130HB-01-19_130Prunus persicahaplotype
131HB-01-19_131Prunus persicahaplotype
132HB-01-19_132Prunus persicahaplotype
134HB-01-19_134Prunus persicahaplotype
135HB-01-19_135Prunus persicahaplotype
136HB-01-19_136Prunus persicahaplotype
137HB-01-19_137Prunus persicahaplotype
138HB-01-19_138Prunus persicahaplotype
139HB-01-19_139Prunus persicahaplotype
140HB-01-19_140Prunus persicahaplotype
141HB-01-19_141Prunus persicahaplotype
97HB-01-19_97Prunus persicahaplotype
105HB-01-19_105Prunus persicahaplotype
114HB-01-19_114Prunus persicahaplotype


Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Alignment of IRSC SNP array 9K to Peach Genome v2.0.a12016-11-21
Prunus persica Whole Genome Assembly v2.0 & Annotation v2.1 (v2.0.a1)2015-01-15
Sequence
>SNP_IGA_131324 ID=SNP_IGA_131324|Name=SNP_IGA_131324|organism=Prunus persica|type=genetic_marker|length=121bp
TGAAGAACCGCCCACCCTAGAAGAGGTCGGCGATGCATGAGGCAATACTC
GAGCAACTGGRAGCTGTGGGTAACCAATTCCTCCACTGTGAGCTGTGGCA
GAAGAAGGCATTCGTGGTTTC
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Peach-PR-F2LG1N/A140.9SNP_IGA_131324View
2Peach-PF-BC1-2017LG1N/A105.9SNP_IGA_131324View
3Peach-PF-F1-2017LG1N/A128.2SNP_IGA_131324View
4Peach-RosBREED-4K-20191N/A180.21SNP_IGA_131324View
Alignments
Feature NameTypeLocationAnalysis
scaffold_1 supercontig scaffold_1:44762368..44762368. Prunus persica Whole Genome v1.0 Assembly & Annotation
Pp01 chromosome Pp01:45053469..45053469. Prunus persica Whole Genome Assembly v2.0 & Annotation v2.1 (v2.0.a1)