SNP_IGA_320761, SNP_IGA_320761 (genetic_marker) Prunus persica

Marker Overview
NameSNP_IGA_320761
dbSNP IDN/A
SNP Array ID
IRSC 9K SNP array for peach:SNP_IGA_320761
IRSC 16K SNP array for peach:SNP_IGA_320761
TypeSNP
SNP Alleles[A/G]
SpeciesPrunus persica
Primer 1SNP_IGA_320761_LEFT_primer_0: CCTCCCATTAGAACATCACCAT
Primer 2SNP_IGA_320761_RIGHT_primer_0: CTCATGGCATTCCATCTCTACA
Product Length217
ContactKsenija Gasic
Contact
NameDetails
Ksenija Gasic
Description:fruit quality, abiotic and biotic tolerance /resistance
First name:Ksenija
Last name:Gasic
Title:Assistant professor
Institution:Clemson University
Address:112 BRC/ 51 New Cherry Rd, Clemson Sc 29634
Country:USA
Email:kgasic@clemson.edu
Phone:864.656.3664.
Fax:864-656-4960
Keywords:Traditional and molecular plant breeding
Libraries
Library NameType
IRSC 9K SNP array for peachSNP_chip
IRSC 16K SNP array for peachSNP_chip
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
SNP_IGA_320761_LEFT_primer_0SNP_IGA_320761_LEFT_primer_0Prunus persicaprimer
SNP_IGA_320761_RIGHT_primer_0SNP_IGA_320761_RIGHT_primer_0Prunus persicaprimer


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
resistance to Monilinia fructicolaqRMF.CxEL-LG3.2009.Fl-rdPrunus persicaQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SNP_IGA_320761SNP_IGA_320761Prunus persicamarker_locus
SNP_IGA_320761SNP_IGA_320761-26.946Prunus persicamarker_locus
SNP_IGA_320761SNP_IGA_320761-18.08Prunus persicamarker_locus


The following haplotype_block feature(s) contains this genetic_marker:

Feature NameUnique NameSpeciesType
Ppe-HB-03-5Ppe-HB-03-5Prunus persicahaplotype_block


The following haplotype feature(s) contains this genetic_marker:

Feature NameUnique NameSpeciesType
8HB-03-5_8Prunus persicahaplotype
9HB-03-5_9Prunus persicahaplotype
10HB-03-5_10Prunus persicahaplotype
11HB-03-5_11Prunus persicahaplotype
12HB-03-5_12Prunus persicahaplotype
16HB-03-5_16Prunus persicahaplotype
17HB-03-5_17Prunus persicahaplotype
18HB-03-5_18Prunus persicahaplotype
19HB-03-5_19Prunus persicahaplotype
20HB-03-5_20Prunus persicahaplotype
21HB-03-5_21Prunus persicahaplotype
22HB-03-5_22Prunus persicahaplotype
27HB-03-5_27Prunus persicahaplotype
28HB-03-5_28Prunus persicahaplotype
29HB-03-5_29Prunus persicahaplotype
30HB-03-5_30Prunus persicahaplotype
31HB-03-5_31Prunus persicahaplotype
32HB-03-5_32Prunus persicahaplotype
34HB-03-5_34Prunus persicahaplotype
39HB-03-5_39Prunus persicahaplotype
40HB-03-5_40Prunus persicahaplotype
6HB-03-5_6Prunus persicahaplotype
7HB-03-5_7Prunus persicahaplotype
14HB-03-5_14Prunus persicahaplotype
23HB-03-5_23Prunus persicahaplotype
24HB-03-5_24Prunus persicahaplotype
36HB-03-5_36Prunus persicahaplotype
38HB-03-5_38Prunus persicahaplotype
4HB-03-5_4Prunus persicahaplotype
5HB-03-5_5Prunus persicahaplotype
13HB-03-5_13Prunus persicahaplotype
15HB-03-5_15Prunus persicahaplotype
25HB-03-5_25Prunus persicahaplotype
26HB-03-5_26Prunus persicahaplotype
37HB-03-5_37Prunus persicahaplotype
41HB-03-5_41Prunus persicahaplotype
43HB-03-5_43Prunus persicahaplotype
45HB-03-5_45Prunus persicahaplotype
46HB-03-5_46Prunus persicahaplotype
47HB-03-5_47Prunus persicahaplotype
50HB-03-5_50Prunus persicahaplotype
52HB-03-5_52Prunus persicahaplotype
56HB-03-5_56Prunus persicahaplotype
57HB-03-5_57Prunus persicahaplotype
58HB-03-5_58Prunus persicahaplotype
59HB-03-5_59Prunus persicahaplotype
60HB-03-5_60Prunus persicahaplotype
61HB-03-5_61Prunus persicahaplotype
62HB-03-5_62Prunus persicahaplotype
64HB-03-5_64Prunus persicahaplotype
65HB-03-5_65Prunus persicahaplotype
66HB-03-5_66Prunus persicahaplotype
67HB-03-5_67Prunus persicahaplotype
68HB-03-5_68Prunus persicahaplotype
69HB-03-5_69Prunus persicahaplotype
33HB-03-5_33Prunus persicahaplotype
42HB-03-5_42Prunus persicahaplotype
44HB-03-5_44Prunus persicahaplotype
2HB-03-5_2Prunus persicahaplotype
3HB-03-5_3Prunus persicahaplotype
35HB-03-5_35Prunus persicahaplotype
48HB-03-5_48Prunus persicahaplotype
51HB-03-5_51Prunus persicahaplotype
53HB-03-5_53Prunus persicahaplotype
54HB-03-5_54Prunus persicahaplotype
55HB-03-5_55Prunus persicahaplotype
49HB-03-5_49Prunus persicahaplotype
63HB-03-5_63Prunus persicahaplotype
71HB-03-5_71Prunus persicahaplotype
72HB-03-5_72Prunus persicahaplotype
74HB-03-5_74Prunus persicahaplotype
75HB-03-5_75Prunus persicahaplotype
77HB-03-5_77Prunus persicahaplotype
78HB-03-5_78Prunus persicahaplotype
79HB-03-5_79Prunus persicahaplotype
81HB-03-5_81Prunus persicahaplotype
70HB-03-5_70Prunus persicahaplotype
80HB-03-5_80Prunus persicahaplotype
82HB-03-5_82Prunus persicahaplotype
85HB-03-5_85Prunus persicahaplotype
86HB-03-5_86Prunus persicahaplotype
73HB-03-5_73Prunus persicahaplotype
76HB-03-5_76Prunus persicahaplotype
89HB-03-5_89Prunus persicahaplotype
90HB-03-5_90Prunus persicahaplotype
92HB-03-5_92Prunus persicahaplotype
84HB-03-5_84Prunus persicahaplotype
87HB-03-5_87Prunus persicahaplotype
88HB-03-5_88Prunus persicahaplotype
94HB-03-5_94Prunus persicahaplotype
95HB-03-5_95Prunus persicahaplotype
96HB-03-5_96Prunus persicahaplotype
99HB-03-5_99Prunus persicahaplotype
101HB-03-5_101Prunus persicahaplotype
102HB-03-5_102Prunus persicahaplotype
103HB-03-5_103Prunus persicahaplotype
104HB-03-5_104Prunus persicahaplotype
106HB-03-5_106Prunus persicahaplotype
110HB-03-5_110Prunus persicahaplotype
111HB-03-5_111Prunus persicahaplotype
112HB-03-5_112Prunus persicahaplotype
115HB-03-5_115Prunus persicahaplotype
116HB-03-5_116Prunus persicahaplotype
117HB-03-5_117Prunus persicahaplotype
118HB-03-5_118Prunus persicahaplotype
119HB-03-5_119Prunus persicahaplotype
120HB-03-5_120Prunus persicahaplotype
121HB-03-5_121Prunus persicahaplotype
83HB-03-5_83Prunus persicahaplotype
91HB-03-5_91Prunus persicahaplotype
93HB-03-5_93Prunus persicahaplotype
100HB-03-5_100Prunus persicahaplotype
107HB-03-5_107Prunus persicahaplotype
108HB-03-5_108Prunus persicahaplotype
109HB-03-5_109Prunus persicahaplotype
113HB-03-5_113Prunus persicahaplotype
125HB-03-5_125Prunus persicahaplotype
126HB-03-5_126Prunus persicahaplotype
130HB-03-5_130Prunus persicahaplotype
131HB-03-5_131Prunus persicahaplotype
132HB-03-5_132Prunus persicahaplotype
134HB-03-5_134Prunus persicahaplotype
135HB-03-5_135Prunus persicahaplotype
136HB-03-5_136Prunus persicahaplotype
137HB-03-5_137Prunus persicahaplotype
138HB-03-5_138Prunus persicahaplotype
139HB-03-5_139Prunus persicahaplotype
140HB-03-5_140Prunus persicahaplotype
141HB-03-5_141Prunus persicahaplotype
97HB-03-5_97Prunus persicahaplotype
105HB-03-5_105Prunus persicahaplotype
114HB-03-5_114Prunus persicahaplotype


Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Alignment of IRSC SNP array 9K to Peach Genome v2.0.a12016-11-21
Prunus persica Whole Genome Assembly v2.0 & Annotation v2.1 (v2.0.a1)2015-01-15
Sequence
>SNP_IGA_320761 ID=SNP_IGA_320761|Name=SNP_IGA_320761|organism=Prunus persica|type=genetic_marker|length=121bp
GAAACCTCCCATTAGAACATCACCATGAAATTGGATGGCATCATCAACCA
TGGTTATTGGRTATGCAAAAAAAGGGCAGTCTTGCGGAGATTGAGTCTCA
GTGGGCCCTCCTCCGATAGCC
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Peach-OC-F23N/A25.9SNP_IGA_320761View
2peach-ZC-F23N/A25.09SNP_IGA_320761View
3Peach-VV-F2G3N/A20.7SNP_IGA_320761View
4Peach_CxEL_F1-physical-Prunus-persicaV1.0CxEL3N/A8422198SNP_IGA_320761View
5Peach-RosBREED-4K-20193N/A37.13SNP_IGA_320761View
6Peach-ZC-F2-20183N/A26.95SNP_IGA_320761View
7Peach_Consensus_map_20183N/A18.08SNP_IGA_320761View
Alignments
Feature NameTypeLocationAnalysis
scaffold_3 supercontig scaffold_3:8422198..8422198. Prunus persica Whole Genome v1.0 Assembly & Annotation
Pp03 chromosome Pp03:9282024..9282024. Prunus persica Whole Genome Assembly v2.0 & Annotation v2.1 (v2.0.a1)