SNP_IGA_415301, SNP_IGA_415301 (genetic_marker) Prunus persica

Marker Overview
NameSNP_IGA_415301
dbSNP IDN/A
SNP Array ID
IRSC 9K SNP array for peach:SNP_IGA_415301
IRSC 16K SNP array for peach:SNP_IGA_415301
3K SeqSNP for peach:SNP_IGA_415301
TypeSNP
SNP Alleles[A/G]
SpeciesPrunus persica
Primer 1SNP_IGA_415301_LEFT_primer_0: TTAGGGAACAGTTCATTGGCTT
Primer 2SNP_IGA_415301_RIGHT_primer_0: GCCATCAATTTCAACACTACGA
Product Length299
Publication[view all]
ContactPere Arus
Ksenija Gasic
Associated WithGWAS0001005
Contact
NameDetails
Pere Arus
First name:Pere
Last name:Arus
Title:Researcher
Institution:IRTA
Address:IRTA, Centre de Recerca en Agrigeno`mica CSIC-IRTA-UAB-UB; Campus UAB, Bellaterra (Cerdanyola del Valle`s), 08193 Barcelona, Spain
Country:Spain
Email:pere.arus@irta.cat
Ksenija Gasic
Description:fruit quality, abiotic and biotic tolerance /resistance
First name:Ksenija
Last name:Gasic
Title:Assistant professor
Institution:Clemson University
Address:112 BRC/ 51 New Cherry Rd, Clemson Sc 29634
Country:USA
Email:kgasic@clemson.edu
Phone:864.656.3664.
Fax:864-656-4960
Keywords:Traditional and molecular plant breeding
Libraries
Library NameType
IRSC 9K SNP array for peachSNP_chip
IRSC 16K SNP array for peachSNP_chip
3K SeqSNP for peachSNP_chip
Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Alignment of IRSC SNP array 9K to Peach Genome v2.0.a12016-11-21
Prunus persica Whole Genome Assembly v2.0 & Annotation v2.1 (v2.0.a1)2015-01-15
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Prunus-TE-F2-20154N/A37.3SA415301View
2Prunus-TE-BC1-T1EG4_T1EN/A37.9SA415301View
3Peach-WB-F2-2015LG4N/A43.01SNP_IGA_415301View
4Peach_Consensus_map_20184N/A49.2SNP_IGA_415301View
5Peach-RosBREED-4K-20194N/A50.09SNP_IGA_415301View
Sequence
>SNP_IGA_415301 ID=SNP_IGA_415301; Name=SNP_IGA_415301; organism=Prunus persica; type=genetic_marker; length=121bp
TATTAATGAGAAAAGGTTTGGTATAAATTTTCTTTTTGCTAGCTGGTTGG
AGACAACGGARTGCAGCAATGTTTTGGATGTTTGTATCATGATCTGTTTT
TAATGCGTAAAGTTTACTTTG
Alignments
Feature NameTypeLocationAnalysis
scaffold_4 supercontig scaffold_4:12512099..12512099. Prunus persica Whole Genome v1.0 Assembly & Annotation
Pp04 chromosome Pp04:12523245..12523245. Prunus persica Whole Genome Assembly v2.0 & Annotation v2.1 (v2.0.a1)
Annotated Terms
The following terms have been associated with this genetic_marker:
Vocabulary: Rosaceae Trait Ontology
TermDefinition
MAIN:000192278fruit ripe 100%
28:Fruit ripen daysfruit development period