SNP_IGA_449118, SNP_IGA_449118 (genetic_marker) Prunus persica

Marker Overview
NameSNP_IGA_449118
dbSNP IDN/A
SNP Array ID
IRSC 9K SNP array for peach:SNP_IGA_449118
IRSC 16K SNP array for peach:SNP_IGA_449118
TypeSNP
SNP Alleles[A/G]
SpeciesPrunus persica
Primer 1SNP_IGA_449118_LEFT_primer_0: ATGAGCTTCCTCTAATCTCCCC
Primer 2SNP_IGA_449118_RIGHT_primer_0: TAAACGGAAGCTCTCACCAAAT
Product Length190
ContactKsenija Gasic
Contact
NameDetails
Ksenija Gasic
Description:fruit quality, abiotic and biotic tolerance /resistance
First name:Ksenija
Last name:Gasic
Title:Assistant professor
Institution:Clemson University
Address:112 BRC/ 51 New Cherry Rd, Clemson Sc 29634
Country:USA
Email:kgasic@clemson.edu
Phone:864.656.3664.
Fax:864-656-4960
Keywords:Traditional and molecular plant breeding
Libraries
Library NameType
IRSC 9K SNP array for peachSNP_chip
IRSC 16K SNP array for peachSNP_chip
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
SNP_IGA_449118_LEFT_primer_0SNP_IGA_449118_LEFT_primer_0Prunus persicaprimer
SNP_IGA_449118_RIGHT_primer_0SNP_IGA_449118_RIGHT_primer_0Prunus persicaprimer


This genetic_marker is adjacent to the following heritable_phenotypic_marker feature(s):

Feature NameUnique NameSpeciesType
flesh adhesionflesh adhesion-FPrunus persicaheritable_phenotypic_marker


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
firmness lossqFRFRMLS.BN-G4.2013.day3.NectarossPrunus persicaQTL
firmness lossqFRFRMLS.BN-G4.2013.day5.NectarossPrunus persicaQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SNP_IGA_449118SNP_IGA_449118Prunus persicamarker_locus
SA449118SA449118Prunus persicamarker_locus
SNP_IGA_449118SNP_IGA_449118-58.54Prunus persicamarker_locus


Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Alignment of IRSC SNP array 9K to Peach Genome v2.0.a12016-11-21
Prunus persica Whole Genome Assembly v2.0 & Annotation v2.1 (v2.0.a1)2015-01-15
Sequence
>SNP_IGA_449118 ID=SNP_IGA_449118|Name=SNP_IGA_449118|organism=Prunus persica|type=genetic_marker|length=121bp
GATGAGAACACTGTAAGTAATTTGGTCAGGAGCCAAACCACTTTGTTTCA
TCAAATTTAGYAACCTATAAGCACTATCAAAATGACCTGCTCTACACTGT
CCATGGATTAATGAGTTATAC
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Peach-OC-F24N/A42SNP_IGA_449118View
2Peach-VV-F2G4N/A49.2SNP_IGA_449118View
3Peach-BO-F1LG4_BN/A53.3SNP_IGA_449118View
4Peach-JF-F2-2016LG4N/A76.3SNP_IGA_449118View
5Peach-PF-Recurrent-2017LG4N/A42.2SNP_IGA_449118View
6Peach-Nectaross-F1G4N/A37.8SNP_IGA_449118View
7Prunus-TE-F2-20154N/A46.5SA449118View
8Peach_Consensus_map_20184N/A58.54SNP_IGA_449118View
Alignments
Feature NameTypeLocationAnalysis
scaffold_4 supercontig scaffold_4:19906327..19906327. Prunus persica Whole Genome v1.0 Assembly & Annotation
Pp04 chromosome Pp04:17994567..17994567. Prunus persica Whole Genome Assembly v2.0 & Annotation v2.1 (v2.0.a1)