SNP_IGA_477951, SNP_IGA_477951 (genetic_marker) Prunus persica

Marker Overview
NameSNP_IGA_477951
dbSNP IDN/A
SNP Array ID
IRSC 9K SNP array for peach:SNP_IGA_477951
IRSC 16K SNP array for peach:SNP_IGA_477951
3K SeqSNP for peach:SNP_IGA_477951
TypeSNP
SNP Alleles[T/G]
SpeciesPrunus persica
Primer 1SNP_IGA_477951_LEFT_primer_0: TCTCCTGAGATCGTTGCAGATA
Primer 2SNP_IGA_477951_RIGHT_primer_0: TCATGATCAACACCTAGCCAAG
Product Length139
ContactKsenija Gasic
Contact
NameDetails
Ksenija Gasic
Description:fruit quality, abiotic and biotic tolerance /resistance
First name:Ksenija
Last name:Gasic
Title:Assistant professor
Institution:Clemson University
Address:112 BRC/ 51 New Cherry Rd, Clemson Sc 29634
Country:USA
Email:kgasic@clemson.edu
Phone:864.656.3664.
Fax:864-656-4960
Keywords:Traditional and molecular plant breeding
Libraries
Library NameType
IRSC 9K SNP array for peachSNP_chip
IRSC 16K SNP array for peachSNP_chip
3K SeqSNP for peachSNP_chip
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
SNP_IGA_477951_LEFT_primer_0SNP_IGA_477951_LEFT_primer_0Prunus persicaprimer
SNP_IGA_477951_RIGHT_primer_0SNP_IGA_477951_RIGHT_primer_0Prunus persicaprimer


This genetic_marker is adjacent to the following heritable_phenotypic_marker feature(s):

Feature NameUnique NameSpeciesType
flesh adhesionflesh adhesion-FPrunus persicaheritable_phenotypic_marker


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SNP_IGA_477951SNP_IGA_477951Prunus persicamarker_locus
SNP_IGA_477951SNP_IGA_477951-54.733Prunus persicamarker_locus


The following haplotype_block feature(s) contains this genetic_marker:

Feature NameUnique NameSpeciesType
Ppe-HB-04-24Ppe-HB-04-24Prunus persicahaplotype_block


The following haplotype feature(s) contains this genetic_marker:

Feature NameUnique NameSpeciesType
8HB-04-24_8Prunus persicahaplotype
9HB-04-24_9Prunus persicahaplotype
10HB-04-24_10Prunus persicahaplotype
11HB-04-24_11Prunus persicahaplotype
12HB-04-24_12Prunus persicahaplotype
16HB-04-24_16Prunus persicahaplotype
17HB-04-24_17Prunus persicahaplotype
18HB-04-24_18Prunus persicahaplotype
19HB-04-24_19Prunus persicahaplotype
20HB-04-24_20Prunus persicahaplotype
21HB-04-24_21Prunus persicahaplotype
22HB-04-24_22Prunus persicahaplotype
27HB-04-24_27Prunus persicahaplotype
28HB-04-24_28Prunus persicahaplotype
29HB-04-24_29Prunus persicahaplotype
30HB-04-24_30Prunus persicahaplotype
31HB-04-24_31Prunus persicahaplotype
32HB-04-24_32Prunus persicahaplotype
34HB-04-24_34Prunus persicahaplotype
39HB-04-24_39Prunus persicahaplotype
40HB-04-24_40Prunus persicahaplotype
6HB-04-24_6Prunus persicahaplotype
7HB-04-24_7Prunus persicahaplotype
14HB-04-24_14Prunus persicahaplotype
23HB-04-24_23Prunus persicahaplotype
24HB-04-24_24Prunus persicahaplotype
36HB-04-24_36Prunus persicahaplotype
38HB-04-24_38Prunus persicahaplotype
4HB-04-24_4Prunus persicahaplotype
5HB-04-24_5Prunus persicahaplotype
13HB-04-24_13Prunus persicahaplotype
15HB-04-24_15Prunus persicahaplotype
25HB-04-24_25Prunus persicahaplotype
26HB-04-24_26Prunus persicahaplotype
37HB-04-24_37Prunus persicahaplotype
41HB-04-24_41Prunus persicahaplotype
43HB-04-24_43Prunus persicahaplotype
45HB-04-24_45Prunus persicahaplotype
46HB-04-24_46Prunus persicahaplotype
47HB-04-24_47Prunus persicahaplotype
50HB-04-24_50Prunus persicahaplotype
52HB-04-24_52Prunus persicahaplotype
56HB-04-24_56Prunus persicahaplotype
57HB-04-24_57Prunus persicahaplotype
58HB-04-24_58Prunus persicahaplotype
59HB-04-24_59Prunus persicahaplotype
60HB-04-24_60Prunus persicahaplotype
61HB-04-24_61Prunus persicahaplotype
62HB-04-24_62Prunus persicahaplotype
64HB-04-24_64Prunus persicahaplotype
65HB-04-24_65Prunus persicahaplotype
66HB-04-24_66Prunus persicahaplotype
67HB-04-24_67Prunus persicahaplotype
68HB-04-24_68Prunus persicahaplotype
69HB-04-24_69Prunus persicahaplotype
33HB-04-24_33Prunus persicahaplotype
42HB-04-24_42Prunus persicahaplotype
44HB-04-24_44Prunus persicahaplotype
2HB-04-24_2Prunus persicahaplotype
3HB-04-24_3Prunus persicahaplotype
35HB-04-24_35Prunus persicahaplotype
48HB-04-24_48Prunus persicahaplotype
51HB-04-24_51Prunus persicahaplotype
53HB-04-24_53Prunus persicahaplotype
54HB-04-24_54Prunus persicahaplotype
55HB-04-24_55Prunus persicahaplotype
49HB-04-24_49Prunus persicahaplotype
63HB-04-24_63Prunus persicahaplotype
71HB-04-24_71Prunus persicahaplotype
72HB-04-24_72Prunus persicahaplotype
74HB-04-24_74Prunus persicahaplotype
75HB-04-24_75Prunus persicahaplotype
77HB-04-24_77Prunus persicahaplotype
78HB-04-24_78Prunus persicahaplotype
79HB-04-24_79Prunus persicahaplotype
81HB-04-24_81Prunus persicahaplotype
70HB-04-24_70Prunus persicahaplotype
80HB-04-24_80Prunus persicahaplotype
82HB-04-24_82Prunus persicahaplotype
85HB-04-24_85Prunus persicahaplotype
86HB-04-24_86Prunus persicahaplotype
73HB-04-24_73Prunus persicahaplotype
76HB-04-24_76Prunus persicahaplotype
89HB-04-24_89Prunus persicahaplotype
90HB-04-24_90Prunus persicahaplotype
92HB-04-24_92Prunus persicahaplotype
84HB-04-24_84Prunus persicahaplotype
87HB-04-24_87Prunus persicahaplotype
88HB-04-24_88Prunus persicahaplotype
94HB-04-24_94Prunus persicahaplotype
95HB-04-24_95Prunus persicahaplotype
96HB-04-24_96Prunus persicahaplotype
99HB-04-24_99Prunus persicahaplotype
101HB-04-24_101Prunus persicahaplotype
102HB-04-24_102Prunus persicahaplotype
103HB-04-24_103Prunus persicahaplotype
104HB-04-24_104Prunus persicahaplotype
106HB-04-24_106Prunus persicahaplotype
110HB-04-24_110Prunus persicahaplotype
111HB-04-24_111Prunus persicahaplotype
112HB-04-24_112Prunus persicahaplotype
115HB-04-24_115Prunus persicahaplotype
116HB-04-24_116Prunus persicahaplotype
117HB-04-24_117Prunus persicahaplotype
118HB-04-24_118Prunus persicahaplotype
119HB-04-24_119Prunus persicahaplotype
120HB-04-24_120Prunus persicahaplotype
121HB-04-24_121Prunus persicahaplotype
83HB-04-24_83Prunus persicahaplotype
91HB-04-24_91Prunus persicahaplotype
93HB-04-24_93Prunus persicahaplotype
100HB-04-24_100Prunus persicahaplotype
107HB-04-24_107Prunus persicahaplotype
108HB-04-24_108Prunus persicahaplotype
109HB-04-24_109Prunus persicahaplotype
113HB-04-24_113Prunus persicahaplotype
125HB-04-24_125Prunus persicahaplotype
126HB-04-24_126Prunus persicahaplotype
130HB-04-24_130Prunus persicahaplotype
131HB-04-24_131Prunus persicahaplotype
132HB-04-24_132Prunus persicahaplotype
134HB-04-24_134Prunus persicahaplotype
135HB-04-24_135Prunus persicahaplotype
136HB-04-24_136Prunus persicahaplotype
137HB-04-24_137Prunus persicahaplotype
138HB-04-24_138Prunus persicahaplotype
139HB-04-24_139Prunus persicahaplotype
140HB-04-24_140Prunus persicahaplotype
141HB-04-24_141Prunus persicahaplotype
97HB-04-24_97Prunus persicahaplotype
105HB-04-24_105Prunus persicahaplotype
114HB-04-24_114Prunus persicahaplotype


Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Alignment of IRSC SNP array 9K to Peach Genome v2.0.a12016-11-21
Prunus persica Whole Genome Assembly v2.0 & Annotation v2.1 (v2.0.a1)2015-01-15
Sequence
>SNP_IGA_477951 ID=SNP_IGA_477951|Name=SNP_IGA_477951|organism=Prunus persica|type=genetic_marker|length=121bp
CCTGAGATCGTTGCAGATATCGTTACTAAACATGTGCATAATATACTTCA
GAAGGTGGATMAGTAGTTGCACTGTTTTCTTTTCAGATCTCAAGAAGCTC
CAAGTTTGCTTGCGCTTGGCT
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1peach-ZC-F24_2N/A4.08SNP_IGA_477951View
2Peach-BO-F1LG4_BN/A54.1SNP_IGA_477951View
3Peach-RosBREED-4K-20194N/A79.58SNP_IGA_477951View
4Peach-ZC-F2-20184N/A54.73SNP_IGA_477951View
Alignments
Feature NameTypeLocationAnalysis
scaffold_4 supercontig scaffold_4:23498809..23498809. Prunus persica Whole Genome v1.0 Assembly & Annotation
Pp04 chromosome Pp04:19895639..19895639. Prunus persica Whole Genome Assembly v2.0 & Annotation v2.1 (v2.0.a1)