SNP_IGA_499780, SNP_IGA_499780 (genetic_marker) Prunus persica

Marker Overview
NameSNP_IGA_499780
dbSNP IDN/A
SNP Array ID
IRSC 9K SNP array for peach:SNP_IGA_499780
IRSC 16K SNP array for peach:SNP_IGA_499780
TypeSNP
SNP Alleles[T/C]
SpeciesPrunus persica
Primer 1SNP_IGA_499780_LEFT_primer_0: ATCTCTTACTTCGGGTTGACCA
Primer 2SNP_IGA_499780_RIGHT_primer_0: ACTTCATCGCCTCTTTCTTCTG
Product Length178
ContactKsenija Gasic
Contact
NameDetails
Ksenija Gasic
Description:fruit quality, abiotic and biotic tolerance /resistance
First name:Ksenija
Last name:Gasic
Title:Assistant professor
Institution:Clemson University
Address:112 BRC/ 51 New Cherry Rd, Clemson Sc 29634
Country:USA
Email:kgasic@clemson.edu
Phone:864.656.3664.
Fax:864-656-4960
Keywords:Traditional and molecular plant breeding
Libraries
Library NameType
IRSC 9K SNP array for peachSNP_chip
IRSC 16K SNP array for peachSNP_chip
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
SNP_IGA_499780_LEFT_primer_0SNP_IGA_499780_LEFT_primer_0Prunus persicaprimer
SNP_IGA_499780_RIGHT_primer_0SNP_IGA_499780_RIGHT_primer_0Prunus persicaprimer


This genetic_marker is adjacent to the following heritable_phenotypic_marker feature(s):

Feature NameUnique NameSpeciesType
flesh adhesionflesh adhesion-FPrunus persicaheritable_phenotypic_marker


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SNP_IGA_499780SNP_IGA_499780Prunus persicamarker_locus
SNP_IGA_499780SNP_IGA_499780-59.4Prunus persicamarker_locus


The following haplotype_block feature(s) contains this genetic_marker:

Feature NameUnique NameSpeciesType
Ppe-HB-04-29Ppe-HB-04-29Prunus persicahaplotype_block


The following haplotype feature(s) contains this genetic_marker:

Feature NameUnique NameSpeciesType
8HB-04-29_8Prunus persicahaplotype
9HB-04-29_9Prunus persicahaplotype
10HB-04-29_10Prunus persicahaplotype
11HB-04-29_11Prunus persicahaplotype
12HB-04-29_12Prunus persicahaplotype
16HB-04-29_16Prunus persicahaplotype
17HB-04-29_17Prunus persicahaplotype
18HB-04-29_18Prunus persicahaplotype
19HB-04-29_19Prunus persicahaplotype
20HB-04-29_20Prunus persicahaplotype
21HB-04-29_21Prunus persicahaplotype
22HB-04-29_22Prunus persicahaplotype
27HB-04-29_27Prunus persicahaplotype
28HB-04-29_28Prunus persicahaplotype
29HB-04-29_29Prunus persicahaplotype
30HB-04-29_30Prunus persicahaplotype
31HB-04-29_31Prunus persicahaplotype
32HB-04-29_32Prunus persicahaplotype
34HB-04-29_34Prunus persicahaplotype
39HB-04-29_39Prunus persicahaplotype
40HB-04-29_40Prunus persicahaplotype
6HB-04-29_6Prunus persicahaplotype
7HB-04-29_7Prunus persicahaplotype
14HB-04-29_14Prunus persicahaplotype
23HB-04-29_23Prunus persicahaplotype
24HB-04-29_24Prunus persicahaplotype
36HB-04-29_36Prunus persicahaplotype
38HB-04-29_38Prunus persicahaplotype
4HB-04-29_4Prunus persicahaplotype
5HB-04-29_5Prunus persicahaplotype
13HB-04-29_13Prunus persicahaplotype
15HB-04-29_15Prunus persicahaplotype
25HB-04-29_25Prunus persicahaplotype
26HB-04-29_26Prunus persicahaplotype
37HB-04-29_37Prunus persicahaplotype
41HB-04-29_41Prunus persicahaplotype
43HB-04-29_43Prunus persicahaplotype
45HB-04-29_45Prunus persicahaplotype
46HB-04-29_46Prunus persicahaplotype
47HB-04-29_47Prunus persicahaplotype
50HB-04-29_50Prunus persicahaplotype
52HB-04-29_52Prunus persicahaplotype
56HB-04-29_56Prunus persicahaplotype
57HB-04-29_57Prunus persicahaplotype
58HB-04-29_58Prunus persicahaplotype
59HB-04-29_59Prunus persicahaplotype
60HB-04-29_60Prunus persicahaplotype
61HB-04-29_61Prunus persicahaplotype
62HB-04-29_62Prunus persicahaplotype
64HB-04-29_64Prunus persicahaplotype
65HB-04-29_65Prunus persicahaplotype
66HB-04-29_66Prunus persicahaplotype
67HB-04-29_67Prunus persicahaplotype
68HB-04-29_68Prunus persicahaplotype
69HB-04-29_69Prunus persicahaplotype
33HB-04-29_33Prunus persicahaplotype
42HB-04-29_42Prunus persicahaplotype
44HB-04-29_44Prunus persicahaplotype
2HB-04-29_2Prunus persicahaplotype
3HB-04-29_3Prunus persicahaplotype
35HB-04-29_35Prunus persicahaplotype
48HB-04-29_48Prunus persicahaplotype
51HB-04-29_51Prunus persicahaplotype
53HB-04-29_53Prunus persicahaplotype
54HB-04-29_54Prunus persicahaplotype
55HB-04-29_55Prunus persicahaplotype
49HB-04-29_49Prunus persicahaplotype
63HB-04-29_63Prunus persicahaplotype
71HB-04-29_71Prunus persicahaplotype
72HB-04-29_72Prunus persicahaplotype
74HB-04-29_74Prunus persicahaplotype
75HB-04-29_75Prunus persicahaplotype
77HB-04-29_77Prunus persicahaplotype
78HB-04-29_78Prunus persicahaplotype
79HB-04-29_79Prunus persicahaplotype
81HB-04-29_81Prunus persicahaplotype
70HB-04-29_70Prunus persicahaplotype
80HB-04-29_80Prunus persicahaplotype
82HB-04-29_82Prunus persicahaplotype
85HB-04-29_85Prunus persicahaplotype
86HB-04-29_86Prunus persicahaplotype
73HB-04-29_73Prunus persicahaplotype
76HB-04-29_76Prunus persicahaplotype
89HB-04-29_89Prunus persicahaplotype
90HB-04-29_90Prunus persicahaplotype
92HB-04-29_92Prunus persicahaplotype
84HB-04-29_84Prunus persicahaplotype
87HB-04-29_87Prunus persicahaplotype
88HB-04-29_88Prunus persicahaplotype
94HB-04-29_94Prunus persicahaplotype
95HB-04-29_95Prunus persicahaplotype
96HB-04-29_96Prunus persicahaplotype
99HB-04-29_99Prunus persicahaplotype
101HB-04-29_101Prunus persicahaplotype
102HB-04-29_102Prunus persicahaplotype
103HB-04-29_103Prunus persicahaplotype
104HB-04-29_104Prunus persicahaplotype
106HB-04-29_106Prunus persicahaplotype
110HB-04-29_110Prunus persicahaplotype
111HB-04-29_111Prunus persicahaplotype
112HB-04-29_112Prunus persicahaplotype
115HB-04-29_115Prunus persicahaplotype
116HB-04-29_116Prunus persicahaplotype
117HB-04-29_117Prunus persicahaplotype
118HB-04-29_118Prunus persicahaplotype
119HB-04-29_119Prunus persicahaplotype
120HB-04-29_120Prunus persicahaplotype
121HB-04-29_121Prunus persicahaplotype
83HB-04-29_83Prunus persicahaplotype
91HB-04-29_91Prunus persicahaplotype
93HB-04-29_93Prunus persicahaplotype
100HB-04-29_100Prunus persicahaplotype
107HB-04-29_107Prunus persicahaplotype
108HB-04-29_108Prunus persicahaplotype
109HB-04-29_109Prunus persicahaplotype
113HB-04-29_113Prunus persicahaplotype
125HB-04-29_125Prunus persicahaplotype
126HB-04-29_126Prunus persicahaplotype
130HB-04-29_130Prunus persicahaplotype
131HB-04-29_131Prunus persicahaplotype
132HB-04-29_132Prunus persicahaplotype
134HB-04-29_134Prunus persicahaplotype
135HB-04-29_135Prunus persicahaplotype
136HB-04-29_136Prunus persicahaplotype
137HB-04-29_137Prunus persicahaplotype
138HB-04-29_138Prunus persicahaplotype
139HB-04-29_139Prunus persicahaplotype
140HB-04-29_140Prunus persicahaplotype
141HB-04-29_141Prunus persicahaplotype
97HB-04-29_97Prunus persicahaplotype
105HB-04-29_105Prunus persicahaplotype
114HB-04-29_114Prunus persicahaplotype


Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Alignment of IRSC SNP array 9K to Peach Genome v2.0.a12016-11-21
Prunus persica Whole Genome Assembly v2.0 & Annotation v2.1 (v2.0.a1)2015-01-15
Sequence
>SNP_IGA_499780 ID=SNP_IGA_499780|Name=SNP_IGA_499780|organism=Prunus persica|type=genetic_marker|length=121bp
TATAGGGATTCAACCAAACCTTTCGGGTCTAGGACTACGGTGGTCCACAC
GGTGGACATTRAAGATACAGACTCAGAAGAAAGAGGCGATGAAGTTTATT
TAGAGGAAGAAGAGTCGGCCG
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Peach-OC-F24N/A43.6SNP_IGA_499780View
2Peach-VV-F2G4N/A52.9SNP_IGA_499780View
3Peach-BO-F1LG4_BN/A54.1SNP_IGA_499780View
4Peach-PF-BC1-2017LG4N/A65.6SNP_IGA_499780View
5Peach-PF-F1-2017LG4N/A71.4SNP_IGA_499780View
6Peach-RosBREED-4K-20194N/A86.88SNP_IGA_499780View
7Peach_Consensus_map_20184N/A59.4SNP_IGA_499780View
Alignments
Feature NameTypeLocationAnalysis
scaffold_4 supercontig scaffold_4:25322958..25322958. Prunus persica Whole Genome v1.0 Assembly & Annotation
Pp04 chromosome Pp04:21720307..21720307. Prunus persica Whole Genome Assembly v2.0 & Annotation v2.1 (v2.0.a1)