SNP_IGA_566322, SNP_IGA_566322 (genetic_marker) Prunus persica

Marker Overview
NameSNP_IGA_566322
dbSNP IDN/A
SNP Array ID
IRSC 9K SNP array for peach:SNP_IGA_566322
IRSC 16K SNP array for peach:SNP_IGA_566322
TypeSNP
SNP Alleles[A/G]
SpeciesPrunus persica
Primer 1SNP_IGA_566322_LEFT_primer_0: CTTTTGGATCAACTCCAATTCC
Primer 2SNP_IGA_566322_RIGHT_primer_0: CTCGATAGTTGCCCGAGTTATC
Product Length252
ContactKsenija Gasic
Associated WithGWAS0001027
Contact
NameDetails
Ksenija Gasic
Description:fruit quality, abiotic and biotic tolerance /resistance
First name:Ksenija
Last name:Gasic
Title:Assistant professor
Institution:Clemson University
Address:112 BRC/ 51 New Cherry Rd, Clemson Sc 29634
Country:USA
Email:kgasic@clemson.edu
Phone:864.656.3664.
Fax:864-656-4960
Keywords:Traditional and molecular plant breeding
Libraries
Library NameType
IRSC 9K SNP array for peachSNP_chip
IRSC 16K SNP array for peachSNP_chip
Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Alignment of IRSC SNP array 9K to Peach Genome v2.0.a12016-11-21
Prunus persica Whole Genome Assembly v2.0 & Annotation v2.1 (v2.0.a1)2015-01-15
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Prunus-TE-F2-20155N/A6.4SA566322View
2Peach_Consensus_map_20185N/A2.73SNP_IGA_566322View
3Peach-RosBREED-4K-20195N/A19.73SNP_IGA_566322View
Sequence
>SNP_IGA_566322 ID=SNP_IGA_566322; Name=SNP_IGA_566322; organism=Prunus persica; type=genetic_marker; length=121bp
AATAATTTCTCTGCATTCAGGATTATTTTTCTATTTTGCTTCAAACTTGA
AAACCCTCCTYTTTTTAAGATAACTCGGGCAACTATCGAGAGTGATAGGA
CAGTGGTCTGAGCCCATCTTT
Alignments
Feature NameTypeLocationAnalysis
scaffold_5 supercontig scaffold_5:4932157..4932157. Prunus persica Whole Genome v1.0 Assembly & Annotation
Pp05 chromosome Pp05:4932817..4932817. Prunus persica Whole Genome Assembly v2.0 & Annotation v2.1 (v2.0.a1)
Annotated Terms
The following terms have been associated with this genetic_marker:
Vocabulary: Rosaceae Trait Ontology
TermDefinition
MAIN:000192278fruit ripe 100%