|
|
Marker Overview
| Name | SNP_IGA_733833 |
|---|
| dbSNP ID | N/A |
|---|
| SNP Array ID | | IRSC 9K SNP array for peach: | SNP_IGA_733833 | | IRSC 16K SNP array for peach: | SNP_IGA_733833 | | 3K SeqSNP for peach: | SNP_IGA_733833 |
|
|---|
| Type | SNP |
|---|
| SNP Alleles | [T/C] |
|---|
| Species | Prunus persica |
|---|
| Source Type | WGS |
|---|
| Primer 1 | SNP_IGA_733833_LEFT_primer_0: AACGTCTGTTTATCCTCCGATG |
|---|
| Primer 2 | SNP_IGA_733833_RIGHT_primer_0: TTAGGTGGGATGATTACTCGCT |
|---|
| Product Length | 268 |
|---|
| Publication | [view all] |
|---|
| Contact | Pere Arus
Ksenija Gasic
|
|---|
| Associated With | GWAS0001431 |
|---|
Analyses
This genetic_marker is derived from or has results from the following analyses
Publications
| Year | Publication |
|---|
| 2012 | Verde I, Bassil N, Scalabrin S, Gilmore B, Lawley CT, Gasic K, Micheletti D, Rosyara UR, Cattonaro F, Vendramin E, Main D, Aramini V, Blas AL, Mockler TC, Bryant DW, Wilhelm L, Troggio M, Sosinski B, Aranzana MJ, Arús P, Iezzoni A, Morgante M, Peace C. Development and evaluation of a 9K SNP array for peach by internationally coordinated SNP detection and validation in breeding germplasm. PloS one. 2012; 7(4):e35668. |
| 2015 | Donoso JM, Eduardo I, Picañol R, Batlle I, Howad W, Aranzana MJ, Arús P. High-density mapping suggests cytoplasmic male sterility with two restorer genes in almond × peach progenies. Horticulture Research 2015 2: 15016 |
Sequence
>SNP_IGA_733833 ID=SNP_IGA_733833; Name=SNP_IGA_733833; organism=Prunus persica; type=genetic_marker; length=121bp
GACGTTACTCTTAACGTCTGTTTATCCTCCGATGCTGCTCAATCTCGGAA
GCTCACTCAAYTGGTAATTGAAGACTTCGCATTTTTCTCCTTTCATTTCC
TCTGTTGAAGTCACTCACTCA
Annotated Terms
The
following terms have been associated with
this genetic_marker:
Vocabulary: Rosaceae Trait Ontology
| Term | Definition |
|---|
| MAIN:rosaceae_trait_ontology:resistance to Monilinia fructicola | resistance to Monilinia fructicola |
|
