snp_scaffold_1_46157131, snp_scaffold_1_46157131 (genetic_marker) Prunus persica

Marker Overview
Namesnp_scaffold_1_46157131
dbSNP IDN/A
SNP Array ID
IRSC 9K SNP array for peach:snp_scaffold_1_46157131
IRSC 16K SNP array for peach:snp_scaffold_1_46157131
3K SeqSNP for peach:snp_scaffold_1_46157131
TypeSNP
SNP Alleles[A/C]
SpeciesPrunus persica
Primer 1snp_scaffold_1_46157131_LEFT_primer_0: AATATGTGACAACCACCAACCA
Primer 2snp_scaffold_1_46157131_RIGHT_primer_0: TTCGAGACAAGTCAGGATTCAA
Product Length128
ContactKsenija Gasic
Contact
NameDetails
Ksenija Gasic
Description:fruit quality, abiotic and biotic tolerance /resistance
First name:Ksenija
Last name:Gasic
Title:Assistant professor
Institution:Clemson University
Address:112 BRC/ 51 New Cherry Rd, Clemson Sc 29634
Country:USA
Email:kgasic@clemson.edu
Phone:864.656.3664.
Fax:864-656-4960
Keywords:Traditional and molecular plant breeding
Libraries
Library NameType
IRSC 9K SNP array for peachSNP_chip
IRSC 16K SNP array for peachSNP_chip
3K SeqSNP for peachSNP_chip
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
snp_scaffold_1_46157131_LEFT_primer_0snp_scaffold_1_46157131_LEFT_primer_0Prunus persicaprimer
snp_scaffold_1_46157131_RIGHT_primer_0snp_scaffold_1_46157131_RIGHT_primer_0Prunus persicaprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
snp_scaffold_1_46157131snp_scaffold_1_46157131Prunus persicamarker_locus


Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Alignment of IRSC SNP array 9K to Peach Genome v2.0.a12016-11-21
Prunus persica Whole Genome Assembly v2.0 & Annotation v2.1 (v2.0.a1)2015-01-15
Sequence
>snp_scaffold_1_46157131 ID=snp_scaffold_1_46157131|Name=snp_scaffold_1_46157131|organism=Prunus persica|type=genetic_marker|length=201bp
GATTTAAATATCACTGAATTCATATTATTGAATGCATACCTCTGAAGAAG
ATTAACAAATATGTGACAACCACCAACCAGATTGACCTGTTCAAGGAAAG
MTGCAAGCAGTGGTTTTTGAGAAAGTGCTCGAATAATCATATGTAAAACA
TCTTCAATACAGGTTGAATCCTGACTTGTCTCGAAAAAAGCTATTAGAGC
T
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Peach-PR-F2LG1N/A136.2snp_scaffold_1_46157131View
Alignments
Feature NameTypeLocationAnalysis
scaffold_1 supercontig scaffold_1:46157131..46157131. Prunus persica Whole Genome v1.0 Assembly & Annotation
Pp01 chromosome Pp01:43658679..43658679. Prunus persica Whole Genome Assembly v2.0 & Annotation v2.1 (v2.0.a1)