ssrPaCITA27 (genetic_marker) Prunus armeniaca

Marker Overview
NamessrPaCITA27
Genbank IDAF324917
TypeSSR
SpeciesPrunus armeniaca
Repeat Motif(TC)8(TA)6(TG)17
Primer 1ssrPaCITA27.Forward Primer: GATCCCTCAACTGAATCTCTC CGTCACAACAATAGATGCGAAGG
Publication[view all]
ContactA. Da Camara Machado
Maria Badenes
Igor Pacheco
Contact
NameDetails
A. Da Camara Machado
First name:Artur
Last name:Da Camara Machado
Institution:Universidade dos Acores, Portugal
Address:Universidade dos Acores, Departamento de Ciencias Agrarias, Terra-Chz, 9701851 Angra do Heroismo, Portugal
Email:amachado@angra.uac.pt
Maria Badenes
First name:Maria 
Last name:Badenes
Institution:Instituto Valenciano de Investigaciones Agrarias (IVIA)
Address:Instituto Valenciano de Investigaciones Agrarias, Apartado Oficial 46113 Moncada, Valencia, Spain
Country:Spain
Email:badenes_mlu@gva.es
Igor Pacheco
First name:Igor
Last name:Pacheco
Title:Researcher
Institution:Università degli Studi di Milano
Address:Dipartimento di Scienze Agrarie e Ambientali, Produzione, Territorio, Agroenergia, Università degli Studi di Milano, Via Celoria 2, 20133 Milan, Italy
Country:Italy
Email:igorpachecocruz@gmail.com
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerssrPaCITA27.Forward PrimerPrunus armeniacaprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
ssrPaCITA27ssrPaCITA27Prunus armeniacamarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Peach-ScB-F2-2007G2N/A11.55ssrPaCITA27View
2Peach_CxEL_F1CxEL2N/A0ssrPaCITA27View
3Peach-CF-F2G2N/A2.5ssrPaCITA27View