ssrPaCITA5 (genetic_marker) Prunus armeniaca

Marker Overview
NamessrPaCITA5
Genbank IDAF324250
TypeSSR
SpeciesPrunus armeniaca
Source Typegenomic DNA
Repeat Motif(GT)16
PCR Condition94C 5 min, 94C 30 sec, 58C 30sec, 72C 45 sec, 72 sec 10 min
Primer 1ssrPaCITA5.Forward Primer: GTTGTGTTTACTTTTTTCTTAACGGGTATCACAAGTGAGAACATAAGAGG
Primer 2ssrPaCITA5_F: TTGTGTTTACTTTTTTCTTAACGG
Primer 3ssrPaCITA5_R: GTATCACAAGTGAGAACATAAGAGG
PolymorphismP_ ssrPaCITA5
Publication[view all]
ContactA. Da Camara Machado
Maria Badenes
Publications
YearPublication
2002Mol Ecol Notes, 2: 24-26
Contact
NameDetails
A. Da Camara Machado
First name:Artur
Last name:Da Camara Machado
Institution:Universidade dos Acores, Portugal
Address:Universidade dos Acores, Departamento de Ciencias Agrarias, Terra-Chz, 9701851 Angra do Heroismo, Portugal
Email:amachado@angra.uac.pt
Maria Badenes
First name:Maria 
Last name:Badenes
Institution:Instituto Valenciano de Investigaciones Agrarias (IVIA)
Address:Instituto Valenciano de Investigaciones Agrarias, Apartado Oficial 46113 Moncada, Valencia, Spain
Country:Spain
Email:badenes_mlu@gva.es
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
ssrPaCITA5_FssrPaCITA5_FPrunus armeniacaprimer
ssrPaCITA5_RssrPaCITA5_RPrunus armeniacaprimer
Forward PrimerssrPaCITA5.Forward PrimerPrunus armeniacaprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
ssrPaCITA5ssrPaCITA5Prunus armeniacamarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apricot-LL-F2-Lito-2011LG1N/A33.9ssrPaCITA5View
2Apricot-integrated-Goldrich-2011LG1N/A25.5ssrPaCITA5View