UDP-008 (genetic_marker) Prunus persica | GDR

Marker Overview

Marker Overview


Name	UDP-008
Genbank ID	N/A
Type	SSR
Species	Prunus persica
Germplasm	Redhaven
Source Type	Genomic
Repeat Motif	CT and GT
Primer 1	UDP-008.Forward Primer: TTGTACACACCCTCAGCCTG
Primer 2	UDP-008.Reverse Primer: TGCTGAGGTTCAGGTGAGTG
Product Length	128-138
Polymorphism	P_ UDP-008
Publication	[view all]
Contact	R. Testolin Maria Badenes

Contact

Name

Details

R. Testolin

First name:	Raffaele
Last name:	Testolin
Institution:	University of Udine, Italy
Address:	Dipartimento di Scienze Agrarie e Ambientali University of Udine Via delle Scienze 208 I-33100 Udine, Italy
Country:	Italy
Email:	raffaele.testolin@uniud.it
Phone:	0432 558632

Maria Badenes

First name:	Maria
Last name:	Badenes
Institution:	Instituto Valenciano de Investigaciones Agrarias (IVIA)
Address:	Instituto Valenciano de Investigaciones Agrarias, Apartado Oficial 46113 Moncada, Valencia, Spain
Country:	Spain
Email:	badenes_mlu@gva.es

Publications


Year	Publication
1999	Theoretical and applied genetics. Theor. appl. genet. July 1999. v. 99 (1/2) p. 65-72. ISSN 0040-5752; THAGA6
2005	Scientia Horticulturae, 103: 305?315
2000	Testolin R, Marrazzo T, Cipriani G, Quarta R, Verde I, Dettori MT, Pancaldi M, Sansavini S. Microsatellite DNA in peach (Prunus persica L. Batsch) and its use in fingerprinting and testing the genetic origin of cultivars. Genome / National Research Council Canada = Génome / Conseil national de recherches Canada. 2000 Jun; 43(3):512-20.

Germplasm


Stock Name	Type
Redhaven	accession

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Almond-RD-F1	G3	N/A	36.5	UDP-008	View
2	Peach-PF-BC1-2005	G3	N/A	59.8	UDP-008	View
3	Peach-SP-BC2-2004	G3	N/A	64	UDP-008	View