|
Marker Overview
Name | 01a6 |
Genbank ID | N/A |
Type | SSR |
Species | Malus x domestica |
Repeat Motif | (ga)21 |
Primer 1 | 01a6.forward primer: aggattgctggaaaaggagg |
Primer 2 | 01a6.reverse primer: tta gac gac gct act tgt cct |
Primer 3 | NZ01a6.forward primer: aggattgctggaaaaggagg |
Primer 4 | NZ01a6.reverse primer: tta gac gac gct act tgt cct |
Product Length | 136 |
Publication | [view all] |
Contact | A. Torres Johan Van Huylenbroeck P. Guilford
|
Publications
Year | Publication |
2010 | Moghaddam HH, Leus L, Van Huylenbroeck J, Van Bockstaele E, Riek JD. Pathotype dependent resistance mapping for powdery mildew in a
diploid rose population. Acta Hort. 2010. 870: 103-107 |
2005 | Dugo ML, Satovic Z, Millán T, Cubero JI, Rubiales D, Cabrera A, Torres AM. Genetic mapping of QTLs controlling horticultural traits in diploid roses. Theoretical and Applied Genetics. 2005 Aug; 111(3):511-520. |
1997 | Guilford P, Prakash S, Zhu JM, Rikkerink E, Gardiner S, Bassett H, Forster R. Microsatellites in Malus X domestica (apple): abundance, polymorphism and cultivar identification. Theoretical and Applied Genetics. 1997; 94(2):249-254. |
|