RosBREED_snp_tart_cherry_a_Pp1_10178231, RosBREED_snp_tart_cherry_a_Pp1_10178231 (genetic_marker) Prunus cerasus

Marker Overview
NameRosBREED_snp_tart_cherry_a_Pp1_10178231
dbSNP IDss490546026
SNP Array ID
IRSC 6K SNP array for cherry:RosBREED_snp_tart_cherry_a_Pp1_10178231
TypeSNP
SNP AllelesA/G
SpeciesPrunus cerasus
Libraries
Library NameType
IRSC 6K SNP array for cherrySNP_chip
Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Alignment of IRSC 6K SNP array for cherry to Peach Genome v2.0.a12016-11-21
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Prunus-TE-6K cherry SNP-estimate1N/A13.96RosBREED_snp_tart_cherry_a_Pp1_10178231View
2sweet cherry-consensus-map-2012-6K cherry SNP-estimate1N/A48.84RosBREED_snp_tart_cherry_a_Pp1_10178231View
3Sweet Cherry-C-F1LG1N/A21.7RosBREED_snp_tart_cherry_a_Pp1_10178231View
4Sweet Cherry-VxC-F1LG1N/A39.62RosBREED_snp_tart_cherry_a_Pp1_10178231View
5Sweet Cherry-CxC-F2LG1N/A16.43RosBREED_snp_tart_cherry_a_Pp1_10178231View
6Sweet Cherry-RosBREED-3.8K-20201N/A32.81RosBREED_snp_tart_cherry_a_Pp1_10178231View
7Sweet Cherry-RosBREED-1.6K-20191N/A32.03RosBREED_snp_tart_cherry_a_Pp1_10178231View
8Sweet Cherry-C-F1-6+9K_array1N/A24.72RosBREED_snp_tart_cherry_a_Pp1_10178231View
9Sweet Cherry-VxC-F1-6+9K_array1N/A138.56RosBREED_snp_tart_cherry_a_Pp1_10178231View
10Sweet_Cherry-Crump-panel-20221N/A32.81RosBREED_snp_tart_cherry_a_Pp1_10178231View
11Sweet Cherry-BTK-Black Tartarian-2013LG01N/A39.7ss490546026View
12Sweet Cherry-RL-Regina-2013LG01N/A31.7ss490546026View
13Sweet Cherry-BTK-F1-2013LG01N/A46ss490546026View
14Sweet Cherry-RL-F1-2013LG01N/A32ss490546026View
Sequence
>RosBREED_snp_tart_cherry_a_Pp1_10178231 ID=RosBREED_snp_tart_cherry_a_Pp1_10178231; Name=RosBREED_snp_tart_cherry_a_Pp1_10178231; organism=Prunus cerasus; type=genetic_marker; length=207bp
AGTATGATTGAATAACATGTCTTTAGAGAAACACAACCCTGTGAATATTA
TGATAGGCAGAACCTGAGAAAAACTTACATAGAATATTGTGACTCATTAT
C[A/G]GGGGAAAACATTTCTCTGTATCCGCAGTGCAACTGAGTTGTCTC
TCCATATAACATGACCTGATAATACATCAGCCAATCCCTATACACCCTTG
CCATCAG