RosBREED_snp_tart_cherry_a_Pp1_08028835, RosBREED_snp_tart_cherry_a_Pp1_08028835 (genetic_marker) Prunus cerasus

Marker Overview
NameRosBREED_snp_tart_cherry_a_Pp1_08028835
dbSNP IDss490545950
SNP Array ID
IRSC 6K SNP array for cherry:RosBREED_snp_tart_cherry_a_Pp1_08028835
TypeSNP
SNP AllelesT/C
SpeciesPrunus cerasus
Libraries
Library NameType
IRSC 6K SNP array for cherrySNP_chip
Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Alignment of IRSC 6K SNP array for cherry to Peach Genome v2.0.a12016-11-21
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Prunus-TE-6K cherry SNP-estimate1N/A11.79RosBREED_snp_tart_cherry_a_Pp1_08028835View
2sweet cherry-consensus-map-2012-6K cherry SNP-estimate1N/A36.56RosBREED_snp_tart_cherry_a_Pp1_08028835View
3Sweet Cherry-VxC-F1LG1N/A30.75RosBREED_snp_tart_cherry_a_Pp1_08028835View
4Sweet Cherry-CxC-F2LG1N/A10.58RosBREED_snp_tart_cherry_a_Pp1_08028835View
5Sweet Cherry-RosBREED-3.8K-20201N/A20.83RosBREED_snp_tart_cherry_a_Pp1_08028835View
6Sweet Cherry-RosBREED-1.6K-20191N/A20.05RosBREED_snp_tart_cherry_a_Pp1_08028835View
7Sweet Cherry-A-F11N/A46.29RosBREED_snp_tart_cherry_a_Pp1_08028835View
8Sweet Cherry-AxS-F11N/A46.29RosBREED_snp_tart_cherry_a_Pp1_08028835View
9Sweet Cherry-VxC-F1-6+9K_array1N/A41.27RosBREED_snp_tart_cherry_a_Pp1_08028835View
10Sweet_Cherry-Crump-panel-20221N/A20.83RosBREED_snp_tart_cherry_a_Pp1_08028835View
Sequence
>RosBREED_snp_tart_cherry_a_Pp1_08028835 ID=RosBREED_snp_tart_cherry_a_Pp1_08028835; Name=RosBREED_snp_tart_cherry_a_Pp1_08028835; organism=Prunus cerasus; type=genetic_marker; length=207bp
CCTATCTTTAGAGGGACGATATCCATTTTTTACTTGACCTTCAAGTCAAG
CAATCTCTGTTGTGGCCCAAGATATCAATCAAAAGCTCTGTGTTTTCTCT
A[T/C]GTATATCTAGGCTTTTAGAAGATGGGATGATATTTTTGTCTTCT
TTTTTTTTAATTTTCACGTAATTGCAAATCCTATTCGAATGTTTTAAATT
AGAGTTC