RosBREED_snp_tart_cherry_a_Pp1_03850920, RosBREED_snp_tart_cherry_a_Pp1_03850920 (genetic_marker) Prunus cerasus

Marker Overview
NameRosBREED_snp_tart_cherry_a_Pp1_03850920
Aliasss490545803
rs268600177
dbSNP IDss490545803
SNP Array ID
IRSC 6K SNP array for cherry:RosBREED_snp_tart_cherry_a_Pp1_03850920
TypeSNP
SNP AllelesT/C
SpeciesPrunus cerasus
Libraries
Library NameType
IRSC 6K SNP array for cherrySNP_chip
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
RosBREED_snp_tart_cherry_a_Pp1_03850920RosBREED_snp_tart_cherry_a_Pp1_03850920Prunus cerasusmarker_locus
RosBREED_snp_tart_cherry_a_Pp1_03850920RosBREED_snp_tart_cherry_a_Pp1_03850920-3.089Prunus cerasusmarker_locus


Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Alignment of IRSC 6K SNP array for cherry to Peach Genome v2.0.a12016-11-21
Sequence
>RosBREED_snp_tart_cherry_a_Pp1_03850920 ID=RosBREED_snp_tart_cherry_a_Pp1_03850920|Name=RosBREED_snp_tart_cherry_a_Pp1_03850920|organism=Prunus cerasus|type=genetic_marker|length=207bp
ACCAGTAACAGTAACGAGGGACTTTATTGTCATGTTTCAAAGAACTGATA
ATCAGATATCTCAATCAATGGGAAGGCCTCTTAGTACAAGATCATATTTC
T[T/C]CTATTTAAAAAGAATGGACTGTAAAATTGACTCAAAAAAATATA
CAAATTACGCCCTTCATTACGCCAAGGGAGTGAAGGAAAGCAAAACCGGA
TCGGAGC
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Sweet Cherry-RosBREED-1.6K-20191N/A11.09RosBREED_snp_tart_cherry_a_Pp1_03850920View
2Prunus-TE-6K cherry SNP-estimate1N/A7.53RosBREED_snp_tart_cherry_a_Pp1_03850920View
3sweet cherry-consensus-map-2012-6K cherry SNP-estimate1N/A16.05RosBREED_snp_tart_cherry_a_Pp1_03850920View
4Sweet Cherry-V-F1LG1N/A13.59RosBREED_snp_tart_cherry_a_Pp1_03850920View
5Sweet Cherry-VxC-F1LG1N/A13.86RosBREED_snp_tart_cherry_a_Pp1_03850920View
6SweetCherry-FX-F1-XX1N/A3.09RosBREED_snp_tart_cherry_a_Pp1_03850920-3.089View
Alignments
Feature NameTypeLocationAnalysis
scaffold_1 supercontig scaffold_1:3850920..3850920. Prunus persica Whole Genome v1.0 Assembly & Annotation
Pp01 chromosome Pp01:3850690..3850690. Prunus persica Whole Genome Assembly v2.0 & Annotation v2.1 (v2.0.a1)