RosBREED_snp_tart_cherry_a_Pp1_03850920, RosBREED_snp_tart_cherry_a_Pp1_03850920 (genetic_marker) Prunus cerasus

Marker Overview
NameRosBREED_snp_tart_cherry_a_Pp1_03850920
dbSNP IDss490545803
SNP Array ID
IRSC 6K SNP array for cherry:RosBREED_snp_tart_cherry_a_Pp1_03850920
TypeSNP
SNP AllelesT/C
SpeciesPrunus cerasus
Libraries
Library NameType
IRSC 6K SNP array for cherrySNP_chip
Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Alignment of IRSC 6K SNP array for cherry to Peach Genome v2.0.a12016-11-21
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Prunus-TE-6K cherry SNP-estimate1N/A7.53RosBREED_snp_tart_cherry_a_Pp1_03850920View
2sweet cherry-consensus-map-2012-6K cherry SNP-estimate1N/A16.05RosBREED_snp_tart_cherry_a_Pp1_03850920View
3Sweet Cherry-V-F1LG1N/A13.59RosBREED_snp_tart_cherry_a_Pp1_03850920View
4Sweet Cherry-VxC-F1LG1N/A13.86RosBREED_snp_tart_cherry_a_Pp1_03850920View
5Sweet Cherry-V-F1-6+9K_array1N/A13.49RosBREED_snp_tart_cherry_a_Pp1_03850920View
6Sweet Cherry-RosBREED-3.8K-20201N/A11.87RosBREED_snp_tart_cherry_a_Pp1_03850920View
7Sweet Cherry-RosBREED-1.6K-20191N/A11.09RosBREED_snp_tart_cherry_a_Pp1_03850920View
8Sweet Cherry-A-F11N/A24.01RosBREED_snp_tart_cherry_a_Pp1_03850920View
9Sweet Cherry-AxS-F11N/A24.01RosBREED_snp_tart_cherry_a_Pp1_03850920View
10Sweet Cherry-VxC-F1-6+9K_array1N/A17.68RosBREED_snp_tart_cherry_a_Pp1_03850920View
11Sweet_Cherry-Crump-panel-20221N/A11.87RosBREED_snp_tart_cherry_a_Pp1_03850920View
12SweetCherry-FX-F1-XX1N/A3.09RosBREED_snp_tart_cherry_a_Pp1_03850920View
13Sweet Cherry-BTK-Black Tartarian-2013LG01N/A16.1ss490545803View
14Sweet Cherry-BTK-F1-2013LG01N/A22.5ss490545803View
Sequence
>RosBREED_snp_tart_cherry_a_Pp1_03850920 ID=RosBREED_snp_tart_cherry_a_Pp1_03850920; Name=RosBREED_snp_tart_cherry_a_Pp1_03850920; organism=Prunus cerasus; type=genetic_marker; length=207bp
ACCAGTAACAGTAACGAGGGACTTTATTGTCATGTTTCAAAGAACTGATA
ATCAGATATCTCAATCAATGGGAAGGCCTCTTAGTACAAGATCATATTTC
T[T/C]CTATTTAAAAAGAATGGACTGTAAAATTGACTCAAAAAAATATA
CAAATTACGCCCTTCATTACGCCAAGGGAGTGAAGGAAAGCAAAACCGGA
TCGGAGC