RosBREED_snp_tart_cherry_a_Pp1_00212925, RosBREED_snp_tart_cherry_a_Pp1_00212925 (genetic_marker) Prunus cerasus

Marker Overview
NameRosBREED_snp_tart_cherry_a_Pp1_00212925
AliasRosBREED_snp_tart_1_00212925
ss490545688
rs268600148
dbSNP IDss490545688
SNP Array ID
IRSC 6K SNP array for cherry:RosBREED_snp_tart_cherry_a_Pp1_00212925
TypeSNP
SNP AllelesA/G
SpeciesPrunus cerasus
Libraries
Library NameType
IRSC 6K SNP array for cherrySNP_chip
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
RosBREED_snp_tart_cherry_a_Pp1_00212925RosBREED_snp_tart_cherry_a_Pp1_00212925Prunus cerasusmarker_locus


The following haplotype_block feature(s) contains this genetic_marker:

Feature NameUnique NameSpeciesType
Pav-HB-01-1Pav-HB-01-1Prunus aviumhaplotype_block


The following haplotype feature(s) contains this genetic_marker:

Feature NameUnique NameSpeciesType
2Pav-HB-01-1_2Prunus cerasushaplotype
3Pav-HB-01-1_3Prunus cerasushaplotype
4Pav-HB-01-1_4Prunus cerasushaplotype
5Pav-HB-01-1_5Prunus cerasushaplotype
6Pav-HB-01-1_6Prunus cerasushaplotype
7Pav-HB-01-1_7Prunus cerasushaplotype
8Pav-HB-01-1_8Prunus cerasushaplotype
9Pav-HB-01-1_9Prunus cerasushaplotype
10Pav-HB-01-1_10Prunus cerasushaplotype
11Pav-HB-01-1_11Prunus cerasushaplotype
12Pav-HB-01-1_12Prunus cerasushaplotype
13Pav-HB-01-1_13Prunus cerasushaplotype
14Pav-HB-01-1_14Prunus cerasushaplotype
15Pav-HB-01-1_15Prunus cerasushaplotype
16Pav-HB-01-1_16Prunus cerasushaplotype
17Pav-HB-01-1_17Prunus cerasushaplotype
18Pav-HB-01-1_18Prunus cerasushaplotype
19Pav-HB-01-1_19Prunus cerasushaplotype
20Pav-HB-01-1_20Prunus cerasushaplotype
21Pav-HB-01-1_21Prunus cerasushaplotype
22Pav-HB-01-1_22Prunus cerasushaplotype
23Pav-HB-01-1_23Prunus cerasushaplotype
24Pav-HB-01-1_24Prunus cerasushaplotype
25Pav-HB-01-1_25Prunus cerasushaplotype
26Pav-HB-01-1_26Prunus cerasushaplotype
27Pav-HB-01-1_27Prunus cerasushaplotype
28Pav-HB-01-1_28Prunus cerasushaplotype
29Pav-HB-01-1_29Prunus cerasushaplotype
30Pav-HB-01-1_30Prunus cerasushaplotype
31Pav-HB-01-1_31Prunus cerasushaplotype
32Pav-HB-01-1_32Prunus cerasushaplotype
33Pav-HB-01-1_33Prunus cerasushaplotype
34Pav-HB-01-1_34Prunus cerasushaplotype
35Pav-HB-01-1_35Prunus cerasushaplotype
36Pav-HB-01-1_36Prunus cerasushaplotype
37Pav-HB-01-1_37Prunus cerasushaplotype
38Pav-HB-01-1_38Prunus cerasushaplotype
39Pav-HB-01-1_39Prunus cerasushaplotype
40Pav-HB-01-1_40Prunus cerasushaplotype
41Pav-HB-01-1_41Prunus cerasushaplotype
42Pav-HB-01-1_42Prunus cerasushaplotype
43Pav-HB-01-1_43Prunus cerasushaplotype
44Pav-HB-01-1_44Prunus cerasushaplotype
45Pav-HB-01-1_45Prunus cerasushaplotype
46Pav-HB-01-1_46Prunus cerasushaplotype
47Pav-HB-01-1_47Prunus cerasushaplotype
48Pav-HB-01-1_48Prunus cerasushaplotype
49Pav-HB-01-1_49Prunus cerasushaplotype
50Pav-HB-01-1_50Prunus cerasushaplotype
51Pav-HB-01-1_51Prunus cerasushaplotype
52Pav-HB-01-1_52Prunus cerasushaplotype
53Pav-HB-01-1_53Prunus cerasushaplotype
54Pav-HB-01-1_54Prunus cerasushaplotype
55Pav-HB-01-1_55Prunus cerasushaplotype
56Pav-HB-01-1_56Prunus cerasushaplotype
57Pav-HB-01-1_57Prunus cerasushaplotype
58Pav-HB-01-1_58Prunus cerasushaplotype
59Pav-HB-01-1_59Prunus cerasushaplotype
60Pav-HB-01-1_60Prunus cerasushaplotype
61Pav-HB-01-1_61Prunus cerasushaplotype
62Pav-HB-01-1_62Prunus cerasushaplotype
63Pav-HB-01-1_63Prunus cerasushaplotype
64Pav-HB-01-1_64Prunus cerasushaplotype
65Pav-HB-01-1_65Prunus cerasushaplotype
66Pav-HB-01-1_66Prunus cerasushaplotype
67Pav-HB-01-1_67Prunus cerasushaplotype
68Pav-HB-01-1_68Prunus cerasushaplotype
69Pav-HB-01-1_69Prunus cerasushaplotype
70Pav-HB-01-1_70Prunus cerasushaplotype
71Pav-HB-01-1_71Prunus cerasushaplotype
72Pav-HB-01-1_72Prunus cerasushaplotype
73Pav-HB-01-1_73Prunus cerasushaplotype
74Pav-HB-01-1_74Prunus cerasushaplotype


Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Alignment of IRSC 6K SNP array for cherry to Peach Genome v2.0.a12016-11-21
Sequence
>RosBREED_snp_tart_cherry_a_Pp1_00212925 ID=RosBREED_snp_tart_cherry_a_Pp1_00212925|Name=RosBREED_snp_tart_cherry_a_Pp1_00212925|organism=Prunus cerasus|type=genetic_marker|length=207bp
TTATTCCAAGTACGTGAACATGCCATAAAAGGGTGGAAAGTAAACGGTTT
ATCAAGATTGGACAAGCATCTCCAACGTTACTCGTTTTTCAGCTAAATTT
T[A/G]GGGCACGTTTAGTAGTGCTTTTAGAGACTTAAGGGAGTTCAAAA
GCATTTGACAGAAAAAGTGCTTATGTATTATAAAAGCACTAAAAGTGTTT
TATGGAA
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Prunus-TE-6K cherry SNP-estimate1N/A0.48RosBREED_snp_tart_cherry_a_Pp1_00212925View
2sweet cherry-consensus-map-2012-6K cherry SNP-estimate1N/A0RosBREED_snp_tart_cherry_a_Pp1_00212925View
3Sweet Cherry-BCxBC-F2LG1N/A0RosBREED_snp_tart_cherry_a_Pp1_00212925View
4Sweet Cherry-RL-F1-2014R1N/A0RosBREED_snp_tart_cherry_a_Pp1_00212925View
5Sour Cherry-M172x25-F1LG1N/A0RosBREED_snp_tart_cherry_a_Pp1_00212925View
6SourCherry-Montx25-F1LG1N/A0RosBREED_snp_tart_cherry_a_Pp1_00212925View
7SourCherry-25x25-F1LG1N/A0RosBREED_snp_tart_cherry_a_Pp1_00212925View
8Sour Cherry-US-F1LG1N/A0RosBREED_snp_tart_cherry_a_Pp1_00212925View
9SourCherry-RE-F1LG1N/A0RosBREED_snp_tart_cherry_a_Pp1_00212925View
10Sweet Cherry-RosBREED-3.8K-20201N/A0.78RosBREED_snp_tart_cherry_a_Pp1_00212925View
11Sweet Cherry-RosBREED-1.6K-20191N/A0RosBREED_snp_tart_cherry_a_Pp1_00212925View
Alignments
Feature NameTypeLocationAnalysis
scaffold_1 supercontig scaffold_1:212925..212925. Prunus persica Whole Genome v1.0 Assembly & Annotation
Pp01 chromosome Pp01:212923..212923. Prunus persica Whole Genome Assembly v2.0 & Annotation v2.1 (v2.0.a1)
PAV_r1.0chr1 chromosome PAV_r1.0chr1:252969..252969. Prunus avium Whole Genome Assembly v1.0 & Annotation v1 (v1.0.a1)