RosBREED_snp_tart_cherry_f_Pp1_00575786, RosBREED_snp_tart_cherry_f_Pp1_00575786 (genetic_marker) Prunus cerasus

Marker Overview
NameRosBREED_snp_tart_cherry_f_Pp1_00575786
AliasRosBREED_snp_tart_1_00575786
ss490545700
rs268600151
dbSNP IDss490545700
SNP Array ID
IRSC 6K SNP array for cherry:RosBREED_snp_tart_cherry_f_Pp1_00575786
TypeSNP
SNP AllelesA/C
SpeciesPrunus cerasus
Libraries
Library NameType
IRSC 6K SNP array for cherrySNP_chip
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
RosBREED_snp_tart_cherry_f_Pp1_00575786RosBREED_snp_tart_cherry_f_Pp1_00575786Prunus cerasusmarker_locus


Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Alignment of IRSC 6K SNP array for cherry to Peach Genome v2.0.a12016-11-21
Sequence
>RosBREED_snp_tart_cherry_f_Pp1_00575786 ID=RosBREED_snp_tart_cherry_f_Pp1_00575786|Name=RosBREED_snp_tart_cherry_f_Pp1_00575786|organism=Prunus cerasus|type=genetic_marker|length=207bp
AACACATCGTTTAATTAGTGAGTCTTGCAATGGCTTATACAATTCAGACA
GTGTTTCCCTATTAGCAAAAACCTTAATCAGTAAAACTGAAATCATGTTC
C[A/C]ACAGTGAACAGTTCAATGAACAAAATGATGGAGTAGAAATGTAT
TTCAGGTGCTAAATATGCTGATTTCAAAATAAACTTGAGCATAAGTATTT
TATGTGC
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Prunus-TE-6K cherry SNP-estimate1N/A1.29RosBREED_snp_tart_cherry_f_Pp1_00575786View
2sweet cherry-consensus-map-2012-6K cherry SNP-estimate1N/A0RosBREED_snp_tart_cherry_f_Pp1_00575786View
Alignments
Feature NameTypeLocationAnalysis
scaffold_1 supercontig scaffold_1:575786..575786. Prunus persica Whole Genome v1.0 Assembly & Annotation
Pp01 chromosome Pp01:575784..575784. Prunus persica Whole Genome Assembly v2.0 & Annotation v2.1 (v2.0.a1)
PAV_r1.0chr1 chromosome PAV_r1.0chr1:626414..626414. Prunus avium Whole Genome Assembly v1.0 & Annotation v1 (v1.0.a1)