RosBREED_snp_tart_cherry_a_Pp1_05857888, RosBREED_snp_tart_cherry_a_Pp1_05857888 (genetic_marker) Prunus cerasus

Marker Overview
NameRosBREED_snp_tart_cherry_a_Pp1_05857888
Aliasss490545873
rs268600195
dbSNP IDss490545873
SNP Array ID
IRSC 6K SNP array for cherry:RosBREED_snp_tart_cherry_a_Pp1_05857888
TypeSNP
SNP AllelesA/G
SpeciesPrunus cerasus
Libraries
Library NameType
IRSC 6K SNP array for cherrySNP_chip
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
RosBREED_snp_tart_cherry_a_Pp1_05857888RosBREED_snp_tart_cherry_a_Pp1_05857888Prunus cerasusmarker_locus


Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Alignment of IRSC 6K SNP array for cherry to Peach Genome v2.0.a12016-11-21
Sequence
>RosBREED_snp_tart_cherry_a_Pp1_05857888 ID=RosBREED_snp_tart_cherry_a_Pp1_05857888|Name=RosBREED_snp_tart_cherry_a_Pp1_05857888|organism=Prunus cerasus|type=genetic_marker|length=207bp
GGATCTCTGCTATTCTTCAACGATTTTCTTCCCATGAATGTTGGAAACTT
AATACAAAACACTACACCAAAGATATATACAGGTTAAGCAAGACGATCAT
T[A/G]TCCGAATCGAGCTTATGGGGAAGTCATGGTGGCAATGACAAATT
ACTGGAGGTTTTTAACCCAAGTAGATGAATAAGCAAAACAAGTGTATGAA
TTTGCCT
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Sweet Cherry-RosBREED-1.6K-20191N/A12.68RosBREED_snp_tart_cherry_a_Pp1_05857888View
2Prunus-TE-6K cherry SNP-estimate1N/A9.57RosBREED_snp_tart_cherry_a_Pp1_05857888View
3sweet cherry-consensus-map-2012-6K cherry SNP-estimate1N/A25.9RosBREED_snp_tart_cherry_a_Pp1_05857888View
4Sweet Cherry-C-F1LG1N/A2.55RosBREED_snp_tart_cherry_a_Pp1_05857888View
5Sweet Cherry-VxC-F1LG1N/A19.08RosBREED_snp_tart_cherry_a_Pp1_05857888View
6Sweet Cherry-CxC-F2LG1N/A2.11RosBREED_snp_tart_cherry_a_Pp1_05857888View
Alignments
Feature NameTypeLocationAnalysis
scaffold_1 supercontig scaffold_1:5857888..5857888. Prunus persica Whole Genome v1.0 Assembly & Annotation
Pp01 chromosome Pp01:6307249..6307249. Prunus persica Whole Genome Assembly v2.0 & Annotation v2.1 (v2.0.a1)