RosBREED_snp_tart_cherry_a_Pp1_01235182, RosBREED_snp_tart_cherry_a_Pp1_01235182 (genetic_marker) Prunus cerasus

Marker Overview
NameRosBREED_snp_tart_cherry_a_Pp1_01235182
Aliasss490545716
rs268600155
dbSNP IDss490545716
SNP Array ID
IRSC 6K SNP array for cherry:RosBREED_snp_tart_cherry_a_Pp1_01235182
TypeSNP
SNP AllelesT/G
SpeciesPrunus cerasus
Libraries
Library NameType
IRSC 6K SNP array for cherrySNP_chip
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
RosBREED_snp_tart_cherry_a_Pp1_01235182RosBREED_snp_tart_cherry_a_Pp1_01235182Prunus cerasusmarker_locus
RosBREED_snp_tart_cherry_a_Pp1_01235182RosBREED_snp_tart_cherry_a_Pp1_01235182-4.16Prunus cerasusmarker_locus


Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Alignment of IRSC 6K SNP array for cherry to Peach Genome v2.0.a12016-11-21
Sequence
>RosBREED_snp_tart_cherry_a_Pp1_01235182 ID=RosBREED_snp_tart_cherry_a_Pp1_01235182|Name=RosBREED_snp_tart_cherry_a_Pp1_01235182|organism=Prunus cerasus|type=genetic_marker|length=207bp
TTTATGTAAAGAAGTACTAACCCCTCTGATTTCTGCGTCTGCTTCTCCGG
ATCTGAAGCTAGTCTGGTGCTATCCATGAAAAACAATGCCTGATCAGTGT
T[T/G]ACTCCACTACTTACTCGAAGCCTGTATTAACCAGACAGTGAAAG
AGAAAATGGGATTTGTTTGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA
GAGAGAG
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Sweet Cherry-RosBREED-1.6K-20191N/A4.16RosBREED_snp_tart_cherry_a_Pp1_01235182View
2Sweet Cherry-V-F1LG1N/A2.52RosBREED_snp_tart_cherry_a_Pp1_01235182View
3Prunus-TE-6K cherry SNP-estimate1N/A2.54RosBREED_snp_tart_cherry_a_Pp1_01235182View
4sweet cherry-consensus-map-2012-6K cherry SNP-estimate1N/A3.22RosBREED_snp_tart_cherry_a_Pp1_01235182View
5Sweet Cherry-VxC-F1LG1N/A2.57RosBREED_snp_tart_cherry_a_Pp1_01235182View
6Sour Cherry-M172x25-F1LG1N/A4.16RosBREED_snp_tart_cherry_a_Pp1_01235182-4.16View
7SourCherry-Montx25-F1LG1N/A4.16RosBREED_snp_tart_cherry_a_Pp1_01235182-4.16View
8SourCherry-25x25-F1LG1N/A4.16RosBREED_snp_tart_cherry_a_Pp1_01235182-4.16View
9SourCherry-RE-F1LG1N/A4.16RosBREED_snp_tart_cherry_a_Pp1_01235182-4.16View
Alignments
Feature NameTypeLocationAnalysis
scaffold_1 supercontig scaffold_1:1235182..1235182. Prunus persica Whole Genome v1.0 Assembly & Annotation
Pp01 chromosome Pp01:1235042..1235042. Prunus persica Whole Genome Assembly v2.0 & Annotation v2.1 (v2.0.a1)