RosBREED_snp_tart_cherry_a_Pp1_01235182, RosBREED_snp_tart_cherry_a_Pp1_01235182 (genetic_marker) Prunus cerasus

Marker Overview
NameRosBREED_snp_tart_cherry_a_Pp1_01235182
dbSNP IDss490545716
SNP Array ID
IRSC 6K SNP array for cherry:RosBREED_snp_tart_cherry_a_Pp1_01235182
TypeSNP
SNP AllelesT/G
SpeciesPrunus cerasus
Libraries
Library NameType
IRSC 6K SNP array for cherrySNP_chip
Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Alignment of IRSC 6K SNP array for cherry to Peach Genome v2.0.a12016-11-21
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Sweet Cherry-V-F1LG1N/A2.52RosBREED_snp_tart_cherry_a_Pp1_01235182View
2Prunus-TE-6K cherry SNP-estimate1N/A2.54RosBREED_snp_tart_cherry_a_Pp1_01235182View
3sweet cherry-consensus-map-2012-6K cherry SNP-estimate1N/A3.22RosBREED_snp_tart_cherry_a_Pp1_01235182View
4Sweet Cherry-VxC-F1LG1N/A2.57RosBREED_snp_tart_cherry_a_Pp1_01235182View
5Sweet Cherry-V-F1-6+9K_array1N/A2.56RosBREED_snp_tart_cherry_a_Pp1_01235182View
6Sweet Cherry-RosBREED-3.8K-20201N/A4.94RosBREED_snp_tart_cherry_a_Pp1_01235182View
7Sweet Cherry-RosBREED-1.6K-20191N/A4.16RosBREED_snp_tart_cherry_a_Pp1_01235182View
8Sweet Cherry-A-F11N/A3.81RosBREED_snp_tart_cherry_a_Pp1_01235182View
9Sweet Cherry-AxS-F11N/A3.81RosBREED_snp_tart_cherry_a_Pp1_01235182View
10Sweet Cherry-VxC-F1-6+9K_array1N/A6.74RosBREED_snp_tart_cherry_a_Pp1_01235182View
11Sweet_Cherry-Crump-panel-20221N/A4.94RosBREED_snp_tart_cherry_a_Pp1_01235182View
12Sour Cherry-M172x25-F1LG1N/A4.16RosBREED_snp_tart_cherry_a_Pp1_01235182View
13SourCherry-Montx25-F1LG1N/A4.16RosBREED_snp_tart_cherry_a_Pp1_01235182View
14SourCherry-25x25-F1LG1N/A4.16RosBREED_snp_tart_cherry_a_Pp1_01235182View
15SourCherry-RE-F1LG1N/A4.16RosBREED_snp_tart_cherry_a_Pp1_01235182View
16Sweet Cherry-RL-Lapins-2013LG01N/A1.7ss490545716View
17Sweet Cherry-RL-F1-2013LG01N/A4.2ss490545716View
Sequence
>RosBREED_snp_tart_cherry_a_Pp1_01235182 ID=RosBREED_snp_tart_cherry_a_Pp1_01235182; Name=RosBREED_snp_tart_cherry_a_Pp1_01235182; organism=Prunus cerasus; type=genetic_marker; length=207bp
TTTATGTAAAGAAGTACTAACCCCTCTGATTTCTGCGTCTGCTTCTCCGG
ATCTGAAGCTAGTCTGGTGCTATCCATGAAAAACAATGCCTGATCAGTGT
T[T/G]ACTCCACTACTTACTCGAAGCCTGTATTAACCAGACAGTGAAAG
AGAAAATGGGATTTGTTTGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA
GAGAGAG
Alignments
Feature NameTypeLocationAnalysis
scaffold_1 supercontig scaffold_1:1235182..1235182. Prunus persica Whole Genome v1.0 Assembly & Annotation
Pp01 chromosome Pp01:1235042..1235042. Prunus persica Whole Genome Assembly v2.0 & Annotation v2.1 (v2.0.a1)
PAV_r1.0chr1 chromosome PAV_r1.0chr1:1273721..1273721. Prunus avium Whole Genome Assembly v1.0 & Annotation v1 (v1.0.a1)