rs159241353, rs159241353 (genetic_marker) Prunus persica

Marker Overview
Namers159241353
dbSNP IDss275392904
TypeSNP
SNP AllelesT/C
SpeciesPrunus persica
Publication[view all]
ContactPedro Martinez-Garcia
CommentBOT
Contact
NameDetails
Pedro Martinez-Garcia
First name:Pedro
Last name:Martinez-Garcia
Title:Researcher
Institution:University of California
Address:Department of Plant Sciences, University of California, One Shields Ave, Davis, CA 95616, USA
Country:China
Email:pjmartinezgarcia@ucdavis.edu
Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
UC Davis 6K Prunus persica SNPs 2011-11-22
Sequence
>rs159241353 ID=rs159241353|Name=rs159241353|organism=Prunus persica|type=genetic_marker|length=125bp
CACTCGTACATCCTCCACACCTGATTGCTTTAGCTTGCATATACATTGCG
AGCGTACTTA[G/A]AGAGAAAGATACCACAGCATGGTTTGAAGAGCTCC
GTGTGGACATGAATGTGGTAAGTCT
Alignments
Feature NameTypeLocationAnalysis
scaffold_8 supercontig scaffold_8:18072251..18072251. Prunus persica Whole Genome v1.0 Assembly & Annotation