RosBREEDSNP_SNP_AG_7097620_Lg7_01872_MAF30_901782_exon2, RosBREEDSNP_SNP_AG_7097620_Lg7_01872_MAF30_901782_exon2 (genetic_marker) Malus x domestica

Marker Overview
NameRosBREEDSNP_SNP_AG_7097620_Lg7_01872_MAF30_901782_exon2
dbSNP IDss475878820
SNP Array ID
480K SNP array for apple:AX-105193506
IRSC 9K SNP array for apple:RosBREEDSNP_SNP_AG_7097620_Lg7_01872_MAF30_901782_exon2
20K SNP array for apple:RosBREEDSNP_SNP_AG_7097620_Lg7_01872_MAF30_901782_exon2
50K SNP array for apple:AX-105193506
TypeSNP
SNP AllelesA/G
Probe 1RosBREEDSNP_SNP_AG_7097620_Lg7_01872_MAF30_901782_exon2.probe: CAGCACATGCAATGGTGGCAAAACAATGACCAACATACCAGTGATTGATT
5' Flanking SequenceCAACAATTCAACAGCACATGCAATGGTGGCAAAACAATGACCAACATACCAGTGATTGAT T
3' Flanking SequenceCCAACAATGTCGTTAGGAACCTTTGGCCTATATTTTTCTGTCCAAGTAAAAGTAGAATGC T
SpeciesMalus x domestica
Publication[view all]
ContactMichela Troggio
Contact
NameDetails
Michela Troggio
First name:Michela
Last name:Troggio
Title:Researcher
Institution:Research and Innovation Centre, Fondazione Edmund Mach
Address:Via Edmund Mach, 1, 38010 San Michele All'adige TN, Italy
Country:Italy
Email:ti.hcamf@oiggort.alehcim
Phone:+39 0461 615111
Fax:+39 0461 650218
Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-MM-F17N/A16a475878820View
2Apple-Honeycrisp_Consensus-F17N/A16.02RosBREEDSNP_SNP_AG_7097620_Lg7_01872_MAF30_901782_exon2View
3Apple-RosBREED-3.9K-20197N/A16.02RosBREEDSNP_SNP_AG_7097620_Lg7_01872_MAF30_901782_exon2View
Sequence
>RosBREEDSNP_SNP_AG_7097620_Lg7_01872_MAF30_901782_exon2 ID=RosBREEDSNP_SNP_AG_7097620_Lg7_01872_MAF30_901782_exon2; Name=RosBREEDSNP_SNP_AG_7097620_Lg7_01872_MAF30_901782_exon2; organism=Malus x domestica; type=genetic_marker; length=75bp
TGGCAAAACAATGACCAACATACCAGTGATTGATT[A/G]CCAACAATGT
CGTTAGGAACCTTTGGCCTATATTT
Alignments
Feature NameTypeLocationAnalysis
MDC019296.221 contig MDC019296.221:10384..10384. Malus x domestica Whole Genome v1.0 Assembly & Annotation
Chr07 chromosome Chr07:6885731..6885731+ Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation