RosBREEDSNP_SNP_GA_17359704_Lg8_01370_MAF50_MDP0000284300_exon4, RosBREEDSNP_SNP_GA_17359704_Lg8_01370_MAF50_MDP0000284300_exon4 (genetic_marker) Malus x domestica

Marker Overview
NameRosBREEDSNP_SNP_GA_17359704_Lg8_01370_MAF50_MDP0000284300_exon4
Aliasss475879100
rs267612046
c475879100
SNP_GA_17359704_Lg8_01370_MAF50_MDP0000284300_exon4
AX-105189013
dbSNP IDss475879100
SNP Array ID
IRSC 9K SNP array for apple:RosBREEDSNP_SNP_GA_17359704_Lg8_01370_MAF50_MDP0000284300_exon4
50K SNP array for apple:RosBREEDSNP_SNP_GA_17359704_Lg8_01370_MAF50_MDP0000284300_exon4
TypeSNP
SNP AllelesA/G
5' Flanking SequenceTGAAGACATCACCATGGGGATTACTAAGGAGTTCA
3' Flanking SequenceTGAGTGCAGAGTCTTTAGAGAAATGTGCCATCAGA
SpeciesMalus x domestica
PolymorphismP_ RosBREEDSNP_SNP_GA_17359704_Lg8_01370_MAF50_MDP0000284300_exon4
Publication[view all]
Libraries
Library NameType
IRSC 9K SNP array for appleSNP_chip
50K SNP array for appleSNP_chip
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
RosBREEDSNP_SNP_GA_17359704_Lg8_01370_MAF50_MDP0000284300_exon4RosBREEDSNP_SNP_GA_17359704_Lg8_01370_MAF50_MDP0000284300_exon4Malus x domesticamarker_locus
RosBREEDSNP_SNP_GA_17359704_Lg8_01370_MAF50_MDP0000284300_exon4RosBREEDSNP_SNP_GA_17359704_Lg8_01370_MAF50_MDP0000284300_exon4-26.519Malus x domesticamarker_locus


Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Sequence
>RosBREEDSNP_SNP_GA_17359704_Lg8_01370_MAF50_MDP0000284300_exon4 ID=RosBREEDSNP_SNP_GA_17359704_Lg8_01370_MAF50_MDP0000284300_exon4|Name=RosBREEDSNP_SNP_GA_17359704_Lg8_01370_MAF50_MDP0000284300_exon4|organism=Malus x domestica|type=genetic_marker|length=71bp
TGAAGACATCACCATGGGGATTACTAAGGAGTTCARTGAGTGCAGAGTCT
TTAGAGAAATGTGCCATCAGA
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-M432-20138N/A35.4RosBREEDSNP_SNP_GA_17359704_Lg8_01370_MAF50_MDP0000284300_exon4View
2Apple-M432-2013-physical-Malus-domestica8N/A17359704RosBREEDSNP_SNP_GA_17359704_Lg8_01370_MAF50_MDP0000284300_exon4View
3Apple-Honeycrisp_Consensus-F18N/A26.52RosBREEDSNP_SNP_GA_17359704_Lg8_01370_MAF50_MDP0000284300_exon4View
Alignments
Feature NameTypeLocationAnalysis
MDC014115.474 contig MDC014115.474:3614..3614. Malus x domestica Whole Genome v1.0 Assembly & Annotation
Chr08 chromosome Chr08:11025523..11025523. Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
Chr08 chromosome Chr08:11025522..11025522. Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation