RosBREEDSNP_SNP_TC_9418092_Lg10_00875_MAF20_1667779_exon1, RosBREEDSNP_SNP_TC_9418092_Lg10_00875_MAF20_1667779_exon1 (genetic_marker) Malus x domestica

Marker Overview
NameRosBREEDSNP_SNP_TC_9418092_Lg10_00875_MAF20_1667779_exon1
dbSNP IDss475879669
SNP Array ID
IRSC 9K SNP array for apple:RosBREEDSNP_SNP_TC_9418092_Lg10_00875_MAF20_1667779_exon1
50K SNP array for apple:AX-105211881
TypeSNP
SNP AllelesT/C
5' Flanking SequenceTCGAAACTTTATCCCTGGTGGGTGTGCGAGCTTGT
3' Flanking SequenceTGTTTGGTTGCCTTTATATTTTCCACTGCGTTAT
SpeciesMalus x domestica
Publication[view all]
Libraries
Library NameType
IRSC 9K SNP array for appleSNP_chip
50K SNP array for appleSNP_chip
Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple_HCGA_F110N/A55.53SNP_TC_9418092_Lg10_00875_MAF20_1667779_exon1View
2Apple_HC64_F110N/A76.65SNP_TC_9418092_Lg10_00875_MAF20_1667779_exon1View
3Apple_HCMO_F110N/A15.26SNP_TC_9418092_Lg10_00875_MAF20_1667779_exon1View
4Apple_HGMM_Consenus10N/A14.26SNP_TC_9418092_Lg10_00875_MAF20_1667779_exon1View
5Apple-RosBREED-3.9K-201910N/A12.69SNP_TC_9418092_Lg10_00875_MAF20_1667779_exon1View
6Pear-PM-F1-Moonglow1N/A0.57RosBREED_SNP_TC_9418092_Lg10_00875_MAF20_1667779_exon1View
7Apple-Honeycrisp_Consensus-F110N/A12.69RosBREEDSNP_SNP_TC_9418092_Lg10_00875_MAF20_1667779_exon1View
8Pear-PH-CG-2017LG1N/A2.02RosBREEDSNP_SNP_TC_9418092_Lg10_00875_MAF20_1667779_exon1View
Sequence
>RosBREEDSNP_SNP_TC_9418092_Lg10_00875_MAF20_1667779_exon1 ID=RosBREEDSNP_SNP_TC_9418092_Lg10_00875_MAF20_1667779_exon1; Name=RosBREEDSNP_SNP_TC_9418092_Lg10_00875_MAF20_1667779_exon1; organism=Malus x domestica; type=genetic_marker; length=70bp
TCGAAACTTTATCCCTGGTGGGTGTGCGAGCTTGTYTGTTTGGTTGCCTT
TATATTTTCCACTGCGTTAT